China
Africa
Explore chapters and articles related to this topic
Forensic Pathophysiology of Asphyxial Death
Published in Sudhir K. Gupta, Forensic Pathology of Asphyxial Deaths, 2022
Respiration is a vital function of an individual. A person respires continuously and in a rhythmic manner. This involves expansion and contraction of the lungs for inhalation of the air needed for oxygenation of blood and for expulsion of carbon dioxide produced as a byproduct of cellular metabolism, respectively. This physiological process requires synchronization between the respiratory, musculoskeletal, cardiovascular and nervous systems. The primary objective is to provide oxygen to the tissues and remove carbon dioxide from them. The lack of oxygen at the tissue level, which may either be partial, termed hypoxia, or complete, which is referred to as anoxia, can lead to death. For respiration to occur in an uninterrupted fashion, the respiratory passages, orifices, lung tissue and the supporting musculoskeletal framework should be free from occlusion, obstructions or any external compressive pressures. Though the respiratory system appears to play a major role in the entire respiratory process, the support of other bodily systems is equally important for its effective functioning, and a disturbance in any of these can lead to respiratory failure. The oxygen concentration of normal room air is approximately 21%, but if this drops to about 10–15%, cognitive and motor functioning could be impaired, and if it further falls to less than 10%, then the individual can lose consciousness. Under normal physiological conditions, humans breathe around 12–15 times per minute, exchanging about 500 mL of air with each breath or 6–8 liters each minute.
Glycine Cytoprotection and Inhibition of Nonlysosomal Calcium-Dependent Proteolysis During Anoxic Injury of Rat Hepatocytes
Published in John J. Lemasters, Constance Oliver, Cell Biology of Trauma, 2020
J. Christopher Nichols, Rolland C. Dickson, Steven F. Bronk, Gregory J. Gores
In summary, our results demonstrate that during anoxia: (a) glycine delays the onset of lethal hepatocellular injury in a concentration-dependent and structurally specific manner; (b) nonlysosomal proteolysis is stimulated during anoxia and is predominantly Ca2+-dependent; (c) glycine inhibits total cellular proteolysis, specifically Ca2+-dependent nonlysosomal proteolysis including calpain proteolysis; and (d) glycine cytoprotection during oxidative stress is also associated with inhibition of Ca2+-dependent proteolysis. The results suggest that glycine cytoprotection against anoxic hepatocellular injury may, in part, be due to a direct inhibition of Ca2+-dependent nonlysosomal proteases including calpains. These findings suggest that Ca2+-dependent nonlysosomal proteolysis and, specifically, calpain proteolysis, may be a critical intermediary event in many forms of hepatocellular injury.
Three Formulations of Brain Death
Published in David Lamb, Death, Brain Death and Ethics, 2020
Brain death is an entity produced by modern technology. The problems and ambiguities it has raised have radical implications, which must be confronted. The President’s Commission recognised that mechanical ventilators and related therapy can now enable physicians to reverse the failure of respiration and circulation in cases of cardiac arrest. If blood-flow to the brain is restored quickly enough, unassisted breathing may return. However, the brain cannot regenerate neurons to replace those that have permanently stopped functioning. Hence prolonged periods without oxygen (anoxia) may lead to the complete and irreversible loss of all brain functions. Given that life is essentially a matter of organisation, the moment of death is not the cessation of breathing and circulation but when breathing and circulation lack neurological integration. Drawing from evidence presented in July 1980, the Commission (DD, 1981, p. 6) concluded that proof of the irreversible absence of all functions in the entire brain, including the brainstem, provides a highly reliable means for declaring death for respirator-maintained patients.
Paracrine effects of mir-210-3p on angiogenesis in hypoxia-treated c-kit-positive cardiac cells
Published in Annals of Medicine, 2023
Louyi Shen, Guan Fan, Guoliang Yang, Zhijie Yang, Chun Gui
The CPCs were transfected with a lentiviral vector containing an inhibitor of miRNA-210-3p. Lentiviruses containing the miRNA-210-3p inhibitor or negative control (NC) were constructed by Genechem Co., Ltd. (Shanghai, China). The lentiviral vector (GV280) had the following element sequence: hU6-MCS-Ubiquitin-EGFP-IRES-puromycin, the reverse complementary sequence was TCAGCCGCTGTCACACGCACAG, and the control insertion sequence was TTCTCCGAACGTGTCACGT. GV280 expresses enhanced green fluorescent protein, which facilitates gene delivery. To transfect CPCs, recombinant miRNA-210-3p inhibitor or miRNA-210-3p NC lentiviral vectors were added to the cells, incubated for 12 h, and the medium replaced with a fresh medium. Fluorescent protein signals were detected by fluorescence microscopy. The obtained groups of transfected CPCs were miR-210-3p inhibitor group and miRNA-210-3p NC group. Both cell groups were treated with anoxia. Total RNA was extracted from the control group (control), hypoxia group (hypoxia), hypoxia + miRNA-210-3p inhibitor group (hypoxia + inhibitor) and hypoxia + miRNA-210-3p NC group (hypoxia + NC) to measure gene transfection efficiency through PCR.
The Dead Donor Rule, Reversibility and Donor Wishes
Published in The American Journal of Bioethics, 2023
Ramesh K. Batra, Stephen R. Latham
We think this point is important because we are worried about the longevity of the authors’ argument that the 5-min waiting period in cDCD essentially guarantees a large level of loss-of-function in the donor’s brain. That may or may not be true at the moment; but recent research has suggested that brain may be much more resilient to anoxic damage than previously thought (Vrselja et al., 2019). The day may soon come when significant loss of brain function to warm ischemia can be reversed. But medical ethics will only permit efforts at such reversal if patients consent to it. And we see no point in denying that a patient is dead if the only path toward reversing the patient’s loss of function is an unethical one. The vague and imprecise potential for “re-animation” here is not only inconsistent with the donor-patient’s wishes, but is also more broadly inconsistent with best-interest standards for patient care. In this instance, we think that an ethical judgment about irreversibility, grounded primarily in the express desires of the patient/donor or their representative, offers more certainty than a technical one.
Prevalence, risk factors, and audiological characteristics of auditory neuropathy
Published in International Journal of Audiology, 2022
Ali A. Almishaal, Shaza Saleh, Hala Alferaih, Osamah Alhelo
Hyperbilirubinemia and hypoxia are well-documented risk factors for developing congenital profound hearing loss. Hyperbilirubinemia represents one of the most common risk factors associated with ANSD and its presence varies among studies ranging from 33% to 50% of ANSD cases (Berlin et al. 2010; Dowley et al. 2009; Madden et al. 2002; Rance et al. 1999; Saluja et al. 2010; Swanepoel, Johl, and Pienaar 2013; Talaat et al. 2009). In our study, we report a lower estimate (27.8%) of children with a history of hyperbilirubinemia. The damaging effects of hyperbilirubinemia on the auditory system results from bilirubin-induced neurotoxicity causing damage to the auditory brainstem nuclei and loss of myelination of auditory nerve fibres rather than hair cells damage (Shapiro and Nakamura 2001). Anoxia has been commonly reported to cause ANSD. In the current study, hypoxia was observed in 7 children (9.27%) suggesting a lower estimate than previous studies that reported more than 50% of children with ANSD having a history of hyperbilirubinemia and/or anoxia following birth (Olds and Oghalai 2015; Rance 2005).