China 
Africa 
Explore chapters and articles related to this topic
Definition of HLA-Dw Determinants Using Homozygous Typing Cells and the Mixed Lymphocyte Culture
Published in M. Kam, Jeffrey L. Bidwell, Handbook of HLA TYPING TECHNIQUES, 2020
The equipment required, preparation of media and cell suspension from patient(s) and potential donor(s), and the conditions of the cultures are identical to those described for HLA-Dw typing. The MLC is set up in checkerboard fashion in sterile 96-well round-bottomed microculture plates. Each responder-stimulator combination is set up in triplicate and autologous as well as allogeneic combinations are also set up for each responder to act as negative and positive controls, respectively. One- and two-way MLCs are normally performed. In the oneway MLC, the stimulator cells are irradiated, whereas in the two-way MLC none of the cells (responders or stimulators) are irradiated. An example is shown in Table 10.
Determination of Toxicity
Published in David Woolley, Adam Woolley, Practical Toxicology, 2017
Cultured cells are essentially available in two types: primary cultures, which are derived from a freshly killed animal (although they may be cryopreserved), and secondary cultures, which are immortal cell lines. Of the first, rat hepatocytes and human peripheral lymphocytes are frequently used. These cells have some limitations, in that they tend to deteriorate quickly; for instance, freshly isolated hepatocytes lose their metabolic capability over a few hours, limiting the time available for testing. Another disadvantage is that, for cells such as hepatocytes, the blood–bile duct polarity of the cell is lost in the process of producing a single-cell suspension. This important aspect of hepatocyte function can be maintained by the use of hepatocyte couplets, in which the biliary side of the cells is maintained in the middle space between two hepatocytes.
Dissemination and adhesion of peritoneal cancer cells to the peritoneal wall
Published in Wim P. Ceelen, Edward A. Levine, Intraperitoneal Cancer Therapy, 2015
Elly De Vlieghere, Marc Bracke, Laurine Verset, Pieter Demetter, Olivier De Wever
Cell lines have the advantage of being easy to handle, available in large numbers, and suitable for repeated experiments. But all cell lines can show artifacts resulting from long-time cell culture and possess a more homogeneous pheno-/genotype as compared to tumors, which often are very heterogeneous [49]. Therefore, it is recommended to use several cell lines [41,50]. Evidently, cells isolated from patients are closer to the in vivo situation and are heterogeneous. The procedure to isolate cells is more labor intensive and needs thorough characterization [25,26,30,51–53]. Cancer cells can be used as a single cell suspension or as cell spheroids. Spheroids can be isolated from ovarian cancer patients ascites directly [4,5] or can be generated from a single cell suspension by liquid gyrotory shaking [54] or culture on a nonadherent substrate [2,29].
Suspended cell lines for inactivated virus vaccine production
Published in Expert Review of Vaccines, 2023
Jiayou Zhang, Zhenyu Qiu, Siya Wang, Zhenbin Liu, Ziling Qiao, Jiamin Wang, Kai Duan, Xuanxuan Nian, Zhongren Ma, Xiaoming Yang
In order to meet the increasing demand for vaccines, cell suspension culture is particularly important. Suspension culture of cells can maximize the use of large bioreactors for cost-effective and large-scale vaccine production; therefore, it is critical to adapt adherent cells to suspension culture. The suspension adaptation process of adherent cells primarily uses artificial interventions to resist apoptosis [117]. The process of suspension adaptation can generally be divided into three steps: serum-free adaptation culture, suspension adaptation culture, and bioreactor high-density adaptation culture; these steps are straightforward and frequently used in the suspension adaptation process of various mammalian cells. In large-scale industrial production, suspension culture of adherent cells in the reactor can provide the surface area required by microcarrier-dependent cells [13,14], thus expanding cell production. However, relative to serum-free suspension cell culture technology, carrier suspension culture technology has many disadvantages and uncertainties in the process of vaccine production, such as limited cell culture area, difficult separation of cells from carriers, and expensive microcarriers. Therefore, the adaptation of low serum to serum-free suspension culture is the most practical method to acclimate adherent cells to suspension cells.
Mesenchymal stem/stromal cells as next-generation drug delivery vehicles for cancer therapeutics
Published in Expert Opinion on Drug Delivery, 2021
Yukiya Takayama, Kosuke Kusamori, Makiya Nishikawa
MSC transplantation can be classified into three categories: cell suspensions, multicellular spheroids, and cell sheets. A cell suspension is the most basic form of drug administration. Single or glued cells, constructed from two or multiple cells suspended in saline or ringer’s solutions, are administered. Cell spheroids or multicellular spheroids are three-dimensionally cultured cell aggregates, ranging between 100‒500 μm in size. Multicellular spheroids can present innate cellular functions by resembling in vivo conditions, including high cell-cell interactions and the deposition of extracellular matrices in the three-dimensional structure [54]. Smruthi et al. demonstrated that spheroid formation of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-expressing MSCs improved TRAIL expression and the anti-tumor effect in a glioblastoma xenograft mouse model [55]. In addition, cell sheets can improve the innate cellular function and survival rate of transplanted MSCs. However, to our knowledge, few studies have been reported on MSC-based cancer therapy using multicellular spheroids or cell sheets. Therefore, we focus on suspended MSCs and discuss the administration route and biodistribution after administration in the following section.
MiR-146b protects against the inflammation injury in pediatric pneumonia through MyD88/NF-κB signaling pathway
Published in Infectious Diseases, 2020
Lei Zhang, Lili Dong, Yu Tang, Min Li, Mingming Zhang
MiR-146b mimic or inhibitor and their negative control (NC) were synthesized by GenePharma Co. (Shanghai, China). MyD88 cDNA was amplified by PCR and cloned into pcDNA3.0 vector (Invitrogen) with a Myc-tag at the C-terminal, designated as MyD88 vector, pcDNA 3.1 vector was used as control vector. MiR-146b mimic or inhibitor was applied for increasing or decreasing miR-146b expression in WI-38 cells. MyD88 vector was used for over-expression of MyD88. 50 nM miR-146b mimic, 100 nM miR-146b inhibitor or MyD88 vector plasmid (2–4 μg) was transfected into WI-38 cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s instructions and the transfection was performed for 48 h. The detailed sequences were listed as following: miR-146b mimic (sense UGAGAACUGAAUUCCAUAGGCU and antisense CCUAUGGAAUUCAG UUCUCAUU), miR-146b inhibitor (AGCCUAUGGAAUUCAGUUCUCA), negative control (UGCUUAGUAUAAGAUGCAGGUAG). The WI-38 cells were then treated with or without 5 μg/ml LPS after transfection [7]. The cell suspension was collected for further analysis.