China 
Africa 
Explore chapters and articles related to this topic
A-Z of Standardisation, Pre-Clinical, Clinical and Toxicological Data
Published in Saroya Amritpal Singh, Regulatory and Pharmacological Basis of Ayurvedic Formulations, 2017
Standardization: The specific gravity, saponification number, iodine number and acid number were 0.915, 199, 102 and 2 respectively. The drug resolved into two spots in the solvent n-butanol, acetic acid, water (75:15:10). The visible spectrum showed two peaks at 420-30 nm and 660 nm (Alam et al. 1989).
Analysis of Essential Oils
Published in K. Hüsnü Can Başer, Gerhard Buchbauer, Handbook of Essential Oils, 2020
Adriana Arigò, Mariosimone Zoccali, Danilo Sciarrone, Peter Q. Tranchida, Paola Dugo, Luigi Mondello
An additional test usually performed in essential oil analysis is the evaporation residue, in which the percentage of the oil that is not released at 100°C is determined. In the specific case of cold-pressed citrus oils, this test enables purity assessment, since a lower amount of residue in an expressed oil may indicate an addition of less valuable distilled volatile components to the oil; an increased residue amount reveals the possible presence ofterpenes with higher molecular weights, through the addition of single compounds (or other essential oils), or of heavier oils, such as rosin oil, cheaper citrus oils or by directly using the citrus oil residue. An example consists of the addition of lime oil to sophisticate lemon oils. In oxidized or polymerized oils, the presence of less-volatile compounds is common; in this case a simple test may be carried out by applying a drop of oil on a piece of filter paper; if a transparent spot persists for a period over 24 h, the oil is most probably degraded. Furthermore, the residue can be subjected to acid and saponification number analyses; for instance, the addition of rosin oil would increase the acid number since this oil, differently from other volatile oils, is characterized by the presence of complex acids. By definition, the acid number is the number of milligrams of potassium hydroxide required to neutralize the free acids contained in 1 g of an oil. This number is preserved in cases in which the essential oil has been carefully dried and stored in dark and airtight recipients. As commonly observed, the acid number increases along the aging process of an oil; oxidation of aldehydes and hydrolysis of esters trigger the increase of the acid number.
Hyaluronic acid injection to restore the lost interproximal papilla: a systematic review
Published in Acta Odontologica Scandinavica, 2022
Adriana Castro-Calderón, Andrea Roccuzzo, Martina Ferrillo, Sneha Gada, José González-Serrano, Manrique Fonseca, Pedro Molinero-Mourelle
Two independent reviewers (ACC and AR) extracted the data. Any disagreements were solved by discussion with a third reviewer (JGS). Data extraction included the following information: The general characteristics of the selected papers: first authors, type of study, recruitment of patients, sample characteristics (population, age, and gender), number, location and type of papilla analysed, inclusion and exclusion criteria and clinician that performed the injections (Tables 1 and 2); Description of the methods used in the selected studies: author and year of publication, type of hyaluronic acid, number of injections, number of sessions, injection technique, post-surgical medication, measurements tools, patient satisfaction and complications (Table 3); Papilla volume changes: vertical gain (mm), gingival volume change (mm2) and reduction of BT area (%) (Table 4).
Dialysis-related amyloidosis associated with a novel β2-microglobulin variant
Published in Amyloid, 2021
Hiroki Mizuno, Junichi Hoshino, Masatomo So, Yuta Kogure, Takeshi Fujii, Yoshifumi Ubara, Kenmei Takaichi, Tetsuko Nakaniwa, Hideaki Tanaka, Genji Kurisu, Fuyuki Kametani, Mayuko Nakagawa, Tsuneaki Yoshinaga, Yoshiki Sekijima, Keiichi Higuchi, Yuji Goto, Masahide Yazaki
The B2M gene sequence was analysed by direct sequencing [12]. Nucleotides were numbered according to the cDNA, with +1 corresponding to the A of the ATG initiation codon. Amino acid number in this study does not include the 20-amino acid signal peptide. The V27M variant (p.V47M) was confirmed by restriction fragment length polymorphism (RFLP) analysis using NdeI (Takara, Japan). RFLP analysis was performed with the primers (5′GTCAAATTTCCTGAATTGCCAT3′ and 5′TACAAGAGATAGAAAGACCAG3′) containing one mismatch nucleotide with a Cytidine (C) instead of a Thymidine (T) at the third position from the 3′ end (underlined C) to create a restriction site for NdeI (CATATG) in the mutant allele.
Evaluation of oxidative stress biomarkers of rabbits’ liver exposed to thermooxidized virgin olive oil obtained from blanquette olive cultivars
Published in Biomarkers, 2019
Djamila Ayari, Fouad Boukazoula, Boudjema Soumati, Lynda Souiki
The deterioration is thus confirmed by the increase in the acid number of the VOO heated for 3 and 4 hours, indicating the degree of its hydrolysis, and by a very high peroxide value during heating. When the fatty substances become rancid, the triglycerides are converted into FAs and glycerol, which causes an increase in the acid number and the peroxide index. The latter is a measure that enables to estimate the quantity of peroxides present in fat. The higher the fat, the more oxidized the fat.