China
Africa
Explore chapters and articles related to this topic
What Is Mold and Why Is It Important?
Published in Jeanne Moldenhauer, Disinfection and Decontamination, 2018
Brian G. Hubka, Jeanne Moldenhauer
The study of cladistics is a method that aims to reconstruct the genealogical descent of organisms through objective and repeatable analysis leading to a natural classification or phylogeny. It results in the tree-branching diagram (called a cladogram or phylogenetic tree) that shows the pattern of relationships between the organisms based on the characters used (Moore et al., 2011b).
Identification of Bio-Minerals and Their Origin in Lime Mortars of Ancient Monument: Thanjavur Palace
Published in International Journal of Architectural Heritage, 2021
Sriram Pradeep, Thirumalini Selvaraj
Molecular characterization is the principal method for identifying the genus of bacteria species and obtaining phylogenetic tree. The most important step in the study of phylogenetic relationships between species is DNA sequence comparison. DNA sequence was carried out using universal forward and reverse primers for all three isolates. VIT1A-27F (5ʹAGAGTTTGATCM\,TGGCTCAG3ʹ)1492R (5ʹAGAGTTTGATCMTGGCTCAG3ʹ), VIT1B 27F (5ʹAGAGTTTGATCMTGGCTCAG3ʹ) 1492R (5ʹ AGAGTTTGATCMTGGCTCAG 3ʹ) and VIT1E-8F (5ʹAGAGTTTGATCCTGGCTCAG3ʹ) 1541R (5ʹAAGGAGGTGATCCAGCCGCA3ʹ); respectively. The conditions for amplification were 25 cycles at 95°C for 2 mins, 55°C for 30 sec and 72°C for 2 min. Sequencing was performed using the BigDye Terminator cycle sequencing kit (Applied Biosystems, USA). Sequencing products were resolved on an Applied Biosystems model 3730XL automated DNA sequencing system (Applied Biosystems, USA). The 16S rRNA sequences were integrated into the database with the automatic alignment tool. A phylogenetic tree was generated by distance matrix analysis using the neighbour-joining method. A database search and comparisons were carried out with the BLAST search using the National Center for Biotechnology Information (NCBI) database (Chenna et al., 2003).