China
Africa
Explore chapters and articles related to this topic
*
Published in Michael Hehenberger, Zhi Xia, Huanming Yang, Our Animal Connection, 2020
Michael Hehenberger, Zhi Xia, Huanming Yang
To understand how knockout mice are created, we need to go back to the role played by DNA in carrying information about the development and function of our bodies throughout life. Our DNA is packaged in chromosomes, which occur in pairs—one inherited from the father and the other from the mother. Exchange of DNA sequences within such chromosome pairs increases genetic variation in the population and occurs by a process called homologous recombination. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. It is used by our cells to accurately repair harmful breaks that occur on both strands of DNA. Homologous recombination also produces new combinations of DNA sequences during meiosis, the process by which eukaryotes make gamete cells, like sperm and egg cells in animals. These new combinations of DNA represent genetic variation in offspring, which in turn enables populations to adapt during the course of evolution. The 2007 Nobel Laureates Mario Capecchi and Oliver Smithies first demonstrated that homologous recombination could be used to specifically modify genes in mammalian cells.
*
Published in Michael Hehenberger, Zhi Xia, Our Animal Connection, 2019
To understand how knockout mice are created, we need to go back to the role played by DNA in carrying information about the development and function of our bodies throughout life. Our DNA is packaged in chromosomes, which occur in pairs—one inherited from the father and the other from the mother. Exchange of DNA sequences within such chromosome pairs increases genetic variation in the population and occurs by a process called homologous recombination. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. It is used by our cells to accurately repair harmful breaks that occur on both strands of DNA. Homologous recombination also produces new combinations of DNA sequences during meiosis, the process by which eukaryotes make gamete cells, like sperm and egg cells in animals. These new combinations of DNA represent genetic variation in offspring, which in turn enables populations to adapt during the course of evolution. The 2007 Nobel Laureates Mario Capecchi and Oliver Smithies first demonstrated that homologous recombination could be used to specifically modify genes in mammalian cells.
Naturally Occurring Polymers—Animals
Published in Charles E. Carraher, Carraher's Polymer Chemistry, 2017
The “crossing over” is not entirely random. Even so, in general, the frequency of homologous recombination in any region separating two points on a chromosome is proportional to the distance between the points. A homologous genetic recombination is simply the recombination between two DNAs of similar (not necessarily the same) sequence. Homologous recombination serves several functions. First, it contributes to the repair of certain types of DNA damage. Second, it provides a transient physical link between chromatids that encourages orderly segregation of chromosomes during the first meiotic cell division. Third, it enhances genetic diversity.
Taguchi analysis and asymmetric keto-reduction of acetophenone and its derivatives by soil filamentous fungal isolate: Penicillium rubens VIT SS1
Published in Preparative Biochemistry & Biotechnology, 2020
Saravanan Jothi, Suneetha Vuppu
The molecular characterization was carried out for thepotential isolates Penicillium sp.001 and Penicillium sp.003. The nuclear ribosomal internal transcribed spacer (ITS) region was amplified using the primers. An amplification of 530 bp product was obtained. The obtained gene sequence was blasted against the GenBank database and Ribosomal Database Project (RDP II). Further, the sequencing of the product and its nucleotide sequences revealed that the soil fungal isolate is closely related to Penicillium rubens with 98% identity. The sequence was submitted to GenBank and the accession number is MK063869.1. The evolutionary history was inferred by using the Neighbor-Joining method. Evolutionary analyses were conducted in MEGA X.[29] A phylogenetic tree is presented in Figure 4. Based on the homologous gene sequences, the strain was named as P. rubens VIT SS1. Similarly the Penicillium sp. 003 is closely related to P. citrinum with 95% homology.
Biotransformation of corn bran derived ferulic acid to vanillic acid using engineered Pseudomonas putida KT2440
Published in Preparative Biochemistry & Biotechnology, 2020
Priya Upadhyay, Nitesh K. Singh, Rasika Tupe, Annamma Odenath, Arvind Lali
The vanAB gene knockout involved in-vitro synthesis of truncated variant of wildtype vanAB gene with homologous end to the gene of interest. This was carried out by using genomic DNA extracted from Pseudomonas putida KT2440 as a template for the PCR (polymerase chain reaction) amplification of the gene fragments. These gene fragments were amplified using high-fidelity PrimeSTAR Max DNA polymerase with the following pairs of primers: (i) AB fragment with vanAB FP (A) attaaaGAATTCATGTACCCCAAAAACACCTGGTACGTC G (EcoR1) and vanAB RP (SOE-B) GGCACCGGCTTGCACCTGTTCGTGTTCCATGTGCCGG GCGGTGACCAC; and (ii) CD fragment with vanAB FP (SOE-C) GTGGTCACCGCCCGGCACATGGAACACGAACAGGTGCAAGCCGGTGCC and vanAB RP (D) gcaacaAAGCTTTCAGATGTCCAGCACCAGCAGCGG (HindIII); wherein bold letters correspond to restriction sites, underline signifies overlapping ends while italics correspond to extranucleotides. AB and CD fragments were spliced together via splicing for overlap extension PCR to obtain truncated allele/gene. The PCR product was digested with the corresponding restriction enzymes indicated in parentheses, purified and then cloned into pk18mobsacB to obtain the vanAB knockout plasmid.
CF-PPI: Centroid based new feature extraction approach for Protein-Protein Interaction Prediction
Published in Journal of Experimental & Theoretical Artificial Intelligence, 2022
Gunjan Sahni, Bhawna Mewara, Soniya Lalwani, Rajesh Kumar
The genomic information-based approach is a subsequent concept of gene fusion, genetic linkage, and phylogenetic profiles. The notion behind this approach is if the interaction between protein pairs is inveterate, their homologous protein pair’s interaction can be certainly predicted. Structure-based approaches consider data of the 3D structure of the protein to predict interaction in homologous proteins, yet limited protein 3D structure is acknowledged, the approach can be applied to inadequate protein pairs. Network topology-based approaches ponder biological interaction networks where node and link characterise protein and interaction between them correspondingly, PPI is evaluated by confidence score of link attain by associating with an original network designed based on accessible data of protein interaction. Certain models of PPI prediction use text mining and literature mining algorithms to excavate associated information of co-occurrence of the proteins in the PubMed abstracts methods. Machine learning perspective of PPI prediction extract information from biological data sources, and generate efficient features of protein pairs (interacting and non-interacting) to train prediction model, subsequently apply machine learning algorithms to classify whether particular protein pair can interact or not. Therefore, these techniques have been employed to predict PPIs, mostly based on arrangements of classification, clustering, and feature selection techniques by representing objects (complexes, protein chains, sites, patches, domains, or motifs) as features (Sowmya & Ranganathan, 2014).