China
Africa
Explore chapters and articles related to this topic
The Viruses
Published in Julius P. Kreier, Infection, Resistance, and Immunity, 2022
In 1970 Temin and Baltimore independently demonstrated a virally-encoded enzyme that transcribes RNA into DNA. This enzyme, RNA-dependent DNA polymerase, is a reverse transcriptase. Prior to this, it had generally been accepted that cellular and viral DNA was the template for production of messenger RJMA. The only known exception to this pattern occurred in the nontumorigenic RNA viruses, which produced their new genomic RNA on their old genomic RNA and transcribed their messenger RNA by the virus-specific, RNA-dependent RNA polymerase.
Cytomegalovirus
Published in Avindra Nath, Joseph R. Berger, Clinical Neurovirology, 2020
Foscarnet is a pyrophosphate analogue with antiviral activity against sensitive strains of CMV [109]. The drug inhibits DNA polymerase by directly binding to the enzyme and acting as a reversible competitive inhibitor. Because this mechanism of action does not require the presence of the protein kinase gene to phosphorylate the antiviral drug (as is necessary with ganciclovir), foscarnet is active against many ganciclovir-resistant strains of CMV. However, other mutations, especially of the viral DNA polymerase, can result in foscarnet resistance.
Genetics
Published in Rachel U Sidwell, Mike A Thomson, Concise Paediatrics, 2020
Rachel U Sidwell, Mike A Thomson
This occurs in a sequence: DNA helix splits to form two single strandsNew complementary base pairs, i.e. C with G, and T with A, are added to the single strands at the 3′ end (so the new DNA replication grows from 5′ to 3’). DNA polymerase enzyme adds the new nucleotides.
Specific FSTL1 polymorphism may determine the risk of cardiomyopathy in patients with acromegaly
Published in Acta Cardiologica, 2022
Suleyman Nahit Sendur, Tuncay Hazirolan, Busra Aydin, Incilay Lay, Mehmet Alikasifoglu, Tomris Erbas
Five to 10 mL peripheral venous blood samples were collected from acromegalic patients. DNA was isolated via ammonium acetate salt precipitation. For the measurement of genomic DNA concentration and purity, a spectrophotometer was utilised. To assess the quantity and purity of DNA, 260 and 280 nm wavelengths values were used. A260/280 and A260/230 ratios were identified to evaluate DNA cleansing. The regions containing a polymorphism (rs1259293), which was previously identified in the literature, were amplified using the polymerase chain reaction (PCR) method [26]. One pair of primers were designed using Primer3® (http://bioinfo.ut.ee/primer3-0.4.0/) for amplification. Taq DNA polymerase enzyme (Thermo Fisher Scientific®, USA) was used for PCR (Thermus aquaticus). The PCR was completed under the amplification conditions determined on the Veriti thermal cycler (Thermo Fisher Scientific®, USA) and the products were checked on an agarose gel.
A Study on the Effect of Vitamins A and C to Modulate the Expression of NKG2D Ligands in Hepatic and Colon Cancer Cells
Published in Nutrition and Cancer, 2021
Mazin A. Zamzami, Mohammad Nasrullah, Hani Choudhry, Mohammad Imran Khan
High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Lithuania, Catalog no. 4368814) uses the random primer scheme for initiating cDNA synthesis. The reverse transcription process is usually used to synthesize DNA from an RNA template to produce complementary DNA (cDNA). Reverse transcriptase is an RNA-dependent DNA polymerase and is directed the synthesis of the first standard DNA by the RNA template and short primer complementary to the 3-end of the RNA. To synthesize cDNA, the reagents of the kit were combined to form a reverse transcription master mix. RNA samples (300 ng) were added after the necessary normalization step with nuclease-free water. The reactions were prepared and thermocycler reactions were programmed following the manufacturer's protocol. Primers for RT-PCR reaction (Table 1) were designed to measure the expression of NKG2DLs, DNA methyltransferases (DNMTs), and TETs. The primer sequences were obtained using the USCS browser. mRNA sequence (only exons) were taken and by the primer three web tool (http://bioinfo.ut.ee/primer3-0.4.0/), primers were designed after confirming all primer characteristics. Moreover, sequences of primers were confirmed (in silico PCR) by the UCSC browser (https://genome.ucsc.edu/cgi-bin/hgPcr). RPL0 was used as a housekeeping gene to compare the expression of other genes.
Correlation of Staphylococcus Epidermidis Phenotype and Its Corneal Virulence
Published in Current Eye Research, 2021
Armando R. Caballero, Aihua Tang, Michael Bierdeman, Richard O’Callaghan, Mary Marquart
The gene sequence for the S. epidermidis Esp protease was obtained from the mass spectrometry data using the GenBank database. Based on these data, primers for the complete gene were designed. The restriction enzyme site NcoI was incorporated into the 5ʹ primer (AACC ATG GCTAAAAAGAGATTTTTATCT) and Bgl II site into the 3ʹ primer (TT AGA TCT CTGAATATTTATATCAGG) for subsequent cloning. The TAA termination signal was eliminated from the 3ʹ primer to allow read-through of the poly- histidine tail. S. epidermidis strain 30111 genomic DNA was used as the template DNA. PCR reactions were conducted with Taq polymerase according to the manufacturer’s instructions (Promega, Madison, WI). The resulting PCR product was purified from agarose gels and cloned into the E. coli expression vector pQE-60 (QIAGEN), which was then transformed into E coli M15 [pREP4].