China
Africa
Explore chapters and articles related to this topic
Hemoglobinopathies
Published in Victor A. Bernstam, Pocket Guide to GENE LEVEL DIAGNOSTICS in Clinical Practice, 2019
The preliminary Hb electrophoresis on parents allows the detection of Hb H, that is, the presence of a single functional α-globin gene in one of the parents. Using two different restriction enzymes (BglII and Asp718, an isoschizomer of KpnI), and testing with two different ζ-globin probes, the ambiguities in assigning the observed haplotypes can be resolved.
Genomic Instability During Aging of Postmitotic Mammalian Cells
Published in Alvaro Macieira-Coelho, Molecular Basis of Aging, 2017
Sequence-specific methylation sites have been examined by comparing DNA fragment sizes generated by isoschizomer restriction enzymes. The most commonly used pair of restriction enzymes have been Hpall (methylation-sensitive) and Mspl (methylation-resistant) which both recognize the same sequence — CCGG. Mspl cleaves whether or not CCGG is methylated at the internal C, whereas Hpall cleaves only unmethylated CCGG. Following enzyme digestion and Southern hybridization to the probe of interest, methylation sites can be deduced by comparing band patterns between the two DNA digests. Studies have shown decreased DNA methylation of LIMd and IAP repetitive sequence families with aging in one or more mouse organs.274,275 Endogenous murine retroviral genomes also become hypomethylated during aging.276 Satellite sequences that are normally highly methylated in postmitotic tissues become undermethylated in senescent organisms.277
Cancer Detection and Prognosis
Published in Attila Lorincz, Nucleic Acid Testing for Human Disease, 2016
Santiago Ropero, Manel Esteller
Two alternatives are currently used to study the distribution of 5-methylcytosine residues in particular DNA sequences: non-bisulfite and bisulfite methods. The first relies on the use of methylation-sensitive and -insensitive restriction endonucleases. One of the restriction enzymes of the isoschizomer pair is able to cut the DNA only when its target is unmethylated (MS-REs), whereas the other is not sensitive to methylated cytosines. Once DNA has been digested with MS-REs, the methylation status of a gene can be determined by Southern blot hybridization or PCR procedures.
Genetic variant of endothelial protein C receptor genes and its serum level in B thalassemic children
Published in Expert Review of Hematology, 2023
M Hesham, Adel S Ali, Shimaa Mahmoud Abogabela, Amal Fawzy, Noura Mostafa Mohamed, Wesam A Mokhtar
A 3 ml of peripheral venous blood was collected on EDTA-coated tubes and refrigerated at −20°C for genomic DNA extraction. G-spin TM complete DNA extraction kit was used to isolate genomic DNA (iNtRON Biotechnology, Seongnam, Korea). A spectrophotometer set to 260 and 280 nm has been used to measure the concentration and purity of DNA. The DNA was kept at a temperature of 20°C until analysis. The upstream primer, 5′–GCTGAAATTTTGTATTCTGTCC–3′, and the downstream primer, 5′–CCAGTATAATGGCTACATTTTACC–3′, were used. The following conditions were used: 95°C for 4 min, followed by 35 cycles at 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. The extension step was applied at a temperature of 72°C for 4 min. The 293 bp PCR product was digested using the isoschizomer of BstE II; Eco91 I restriction enzyme (Fermentas, Lithuania). In a 2% agarose gel, digestion products were examined. The heterozygous band pattern consisted of 251, 176, 75, and 42 bp bands on a 2% agarose gel, while the homozygous band pattern consisted of 251 and 42 bp bands. The PCR was conducted in a definitive volume of 20 μl, which included 10 μl of 2x i-TaqTM PCR Master Mix (iNtRON Biotechnology, Seongnam-Si, Korea), 1 µl of each primer (Biolegio, Nijmegen, Netherland), 4 μl of genomic DNA, and 4μl of deionized water.
Tumor-associated macrophages promote intratumoral conversion of conventional CD4+ T cells into regulatory T cells via PD-1 signalling
Published in OncoImmunology, 2022
Kevin Kos, Camilla Salvagno, Max D. Wellenstein, Muhammad A. Aslam, Denize A. Meijer, Cheei-Sing Hau, Kim Vrijland, Daphne Kaldenbach, Elisabeth A.M. Raeven, Martina Schmittnaegel, Carola H. Ries, Karin E. de Visser
Transduction of CD4+ Tconvs isolated from splenocytes of ROSACAS9-GFP mice was carried out using a modified retroviral pRubic-T2A-Cas9-mCherry vector (https://www.addgene.org/75347/) containing sgRNA targeting exon 2 of Pdcd1. sgRNA-PD-1 was assembled by annealing complementary oligonucleotides 5’-CACCGCAGCTTGTCCAACTGGTCGG-3’ and 5’-AAACCCGACCAGTTGGACAAGCTGC-3’, with BbsI overhangs. Annealed oligo’s were subsequently ligated into the BbsI-digested PxL vector, which provided U6 promotor and gRNA scaffold. Then, gRNA-PD-1, U6 promotor and gRNA scaffold were cloned into pRubic vector using BstBI isoschizomer SfuI and PacI, resulting in pRubic-PD-1 or control pRubic vector, without gRNA. Successful insertion of gRNA into pRubic backbone was confirmed by sanger sequencing on purified DNA using hU6-Forward primer (5’-GAGGGCCTATTTCCCATGATT-3’).
Epigenetic factors of individual radiosensitivity and adaptive capacity
Published in International Journal of Radiation Biology, 2020
Alexandra P. Kravets, Daryna A. Sokolova
Restriction analysis as well as amplification reactions were performed in a four-channel Tertsik DNA amplifier (DNA-Technology, Russia). Three types of restrictases were used: MspI (C…C*GG; C…CGG), HpaII (C…CGG) and MboI (…GATC*) (Fermentas, Germany). The restriction endonucleases HpaII and MspI both cleave the nucleotide sequence CCGG, but the action of HpaII is inhibited if the internal cytosine is methylated. MspI, an isoschizomer of HpaII which cleaves both unmethylated and methylated HpaII sites.