China
Africa
Explore chapters and articles related to this topic
Production of Clinical Lots of Gene Therapy Vectors Using Good Manufacturing Practice: Experience in a University Setting
Published in Eric Wickstrom, Clinical Trials of Genetic Therapy with Antisense DNA and DNA Vectors, 2020
The Human Applications Laboratory (HAL) is a specialized clean room manufacturing facility located at the University of Pennsylvania in the Institute for Human Gene Therapy (IHGT). The IHGT is dedicated to the efficient translation of basic research in the areas of gene transfer technology and gene therapy into pilot human trials. The HAL is a 2200 ft2 laboratory that was developed to provide gene therapy reagents to investigators interested in performing preclinical safety and toxicology studies in appropriate animal models as well as clinical grade reagents for human clinical trials. Its regulatory intent is to conform and operate in accordance with Food and Drug Administration (FDA) guidelines for Good Manufacturing Practice (GMP) and Good Laboratory Practices (GLP). HAL is equipped to work with biohazardous material at the BL2+ level.
Bladder Cancer
Published in Manit Arya, Taimur T. Shah, Jas S. Kalsi, Herman S. Fernando, Iqbal S. Shergill, Asif Muneer, Hashim U. Ahmed, MCQs for the FRCS(Urol) and Postgraduate Urology Examinations, 2020
Vineet Agrawal, Lyndon Gommersall, David Mak
Which of the following statements is FALSE regarding fluorescence-guided biopsy or photodynamic diagnosis (PDD) and resection?The value of fluorescence cystoscopy for improvement of the outcome in relation to progression rate or survival has not been proven.The additional detection rate with PDD for all tumours is about 35% and about 40% for CIS.False positivity can occur due to recent TUR and during the first three months after BCG instillation.A large, multicentre, RCT comparing hexa-aminolaevulinic acid (HAL) fluorescence guided TUR with standard TUR reported an absolute reduction of no more than 9% in the recurrence rate within 9 months in the HAL arm.
Halogenases with Potential Applications for the Synthesis of Halogenated Pharmaceuticals
Published in Peter Grunwald, Pharmaceutical Biocatalysis, 2019
Georgette Rebollar-Pérez, Cynthia Romero-Guido, Antonino Baez, Eduardo Torres
Flavin dependent halogenases (Fl-Hal) are part of the monooxygenases group that have been identified in bacterial and fungal biosynthetic pathways (Latham et al., 2018). They are another type of enzymes that catalyze halogenation through hypohalous acid, although an additional step in the catalytic cycle takes place because these enzymes are highly specific and regioselective catalysts. Most of these enzymes oxidize free reduced flavin (FADH2) using O2 to generate a FAD-OOH activated intermediate (Fig. 16.1c). In addition to the free diffusable flavin reductase described, flavin halogenases from NRPS and PKS pathways require other enzymes for substrate activation or tethering (Weichold et al., 2016). Then, chloride ions react with this species to produce hypohalous acid (Fig. 16.1c). An interesting mechanistic aspect of flavin halogenases is that there is a 10 Å gap between the site where HOCL is produced and the site where the subsequent halogenating step takes place; therefore, HOCL has to migrate through the protein (Sirimulla et al., 2013). At this point, the alternative step among haloperoxidases takes place, a lysine residue in the active site participates orienting hypohalous acid, through H-bonding of the amino group, towards the reduced substrate, improving the regiospecificity of the reaction (Dong et al., 2005). Another possibility is that HOCl may react with the primary amine group in lysine to produce an electrophilic chloramine with a specific orientation which is responsible for the substrate halogenation (Yeh et al., 2007).
Diagnostic value of probe-based confocal laser endomicroscopy versus conventional endoscopic biopsies of non-muscle invasive bladder tumors: a pilot study
Published in Scandinavian Journal of Urology, 2021
Sami Beji, Gitte Wrist Lam, Peter Busch Østergren, Anders Toxvaerd, Jens Sønksen, Mikkel Fode
When evaluating our work, it is important to note that it represents a pilot study with a small number of patients and tumors. However, even in our small cohort, the surgeon missed 5/9 HG lesions, which would remain unacceptable even in a much larger sample. Since CLE is a new method, which has not made its way into clinical practice in urology at this time, the involved clinicians also have limited experience with the method. Therefore, it is possible that results can be improved with an extended educational program and clinical experience. However, discrepancies between CLE and histopathology may also be due to the limited depth of view of the laser probe, which means that imaging only captures the surface of the tumor (55–65 µm). Likewise, it is possible that tumor heterogeneity may limit the practical application of CLE as only parts of the lesions are evaluated during surgery. In addition, there could be an interference between CLE and PDD, but we are not aware of any studies investigating this in vivo. An ex vivo pilot study showed that hexyl aminolevulinic acid (HAL), used in PDD, was insufficient to allow conclusive CLE but combining PDD and CLE allowed guiding CLE by locating areas of interest for CLE examination [13]. As the literature on CLE in bladder lesions is very limited at the current time, more research is needed to explore these possibilities.
Discovery of orally active chalcones as histone lysine specific demethylase 1 inhibitors for the treatment of leukaemia
Published in Journal of Enzyme Inhibition and Medicinal Chemistry, 2021
Yang Li, Ying Sun, Yang Zhou, Xinyang Li, Huan Zhang, Guojun Zhang
Cancer cell lines (Hela, 22RV1, Caco-2, BEL-7402, MOLT-4, OVCAR-3, HCT-8, HIC, IMR-32, HAL-01, KE-37, P30-OHK, SUP-B15 and LC4-1) were maintained in RPMI 1640 medium (Hyclone, Los Angeles, CA, USA) with 10% foetal bovine serum (Hyclone, Los Angeles, USA) and 1% penicillin-streptomycin (Hyclone, Los Angeles, USA) in a humidified atmosphere of 5% CO2 and 95% air at 37 °C. All cell lines were purchased from the China Centre for Type Culture Collection (CCTCC, China). Control containing sequence specific for LSD1 (GGCGAAGGTAGAGTACAGAGA) was described. The shRNA constructs were transfected into MOLT-4 cells using the Lonza Group nucleofector technology in accordance with the manufacturer’s instructions20. MOLT-4&shLSD1 cells and MOLT-4&shControl cells were also established and cultured according to the published references [21,22]. After the incubation for 24 h, cancer cell lines were cultured with the chalcone D6 at different concentrations. Then, 20 μL of MTT (3–(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution (5 mg/ml) was added and the cells were incubated for 4 h. The absorbance was measured using a microplate reader (DeTie Technology Co., Ltd, NanJing, China).
Emerging roles of autophagy in the development and treatment of urothelial carcinoma of the bladder
Published in Expert Opinion on Therapeutic Targets, 2021
Pratishtha Gupta, Niraj Kumar, Minal Garg
Photodynamic therapy is considered as a new and emerging modality for treatment of bladder cancer patients who experience BCG failure. This therapy uses photosensitizing agents, such as 5-aminolevulinic acid, hexaminolevulinate (HAL), or radachlorin. These agents upon administration get activated by light at the appropriate wavelength. Electron microscopic studies on rat xenograft models examine autophagic induction as evidenced by the increased appearance of vacuoles and lipofuscin bodies in the cytoplasm following the photodynamic therapy [62]. Future studies are required to check the efficacy of combinational treatment of bladder cancer patients with photosensitizing agents in conjunction with autophagic inhibitors.