China
Africa
Explore chapters and articles related to this topic
Replicase
Published in Paul Pumpens, Single-Stranded RNA Phages, 2020
The Hfq protein was found in the E. coli nucleoid (Talukder and Ishihama 2015). Recently, a novel critical role was established for the Hfq. It was found that the Hfq serves as a critical switch that modulates bacteria from high-fidelity DNA replication to stress-induced mutagenesis (Chen and Gottesman 2017).
Regulation of flagellar motility and biosynthesis in enterohemorrhagic Escherichia coli O157:H7
Published in Gut Microbes, 2022
Hongmin Sun, Min Wang, Yutao Liu, Pan Wu, Ting Yao, Wen Yang, Qian Yang, Jun Yan, Bin Yang
The RNA-binding protein Hfq is a global post-transcriptional regulator that is essential for the fitness and virulence of an increasing number of bacterial pathogens.102 Hfq promotes interactions between an sRNA and its target mRNA to regulate gene expression; however, Hfq can also function independently by influencing polyadenylation or translation of mRNAs.103 Transcriptome and qRT-PCR analyses showed that the deletion of hfq in EHEC O157:H7 led to decreased expression of the two-component system qseBC,50 which is involved in the transcriptional activation of flagellar genes.43,44 In contrast, Hfq post-transcriptionally represses the expression of grlA that encodes a negative regulator of flagellar gene transcription.51In vitro analyses revealed that the Hfq distal face directly binds near the translational initiation site of the grlA mRNA and inhibits its translation in an sRNA-independent manner in EHEC O157:H7.52 It is therefore conceivable that Hfq can indirectly activate EHEC O157:H7 motility and flagellar gene expression through post-transcriptional regulation of qseBC and grlA.
Tryptanthrin, a potential biofilm inhibitor against toxigenic Vibrio cholerae, modulating the global quorum sensing regulator, LuxO
Published in Biofouling, 2019
Lekshmi Narendrakumar, Mary Theresa, Sivakumar Krishnankutty Chandrika, Sabu Thomas
For the gene expression studies by real time PCR, the total RNA from untreated planktonic, untreated biofilm, treated planktonic and treated biofilm stages were harvested by the TRIzol method as previously described (Rio et al. 2010). The purity and integrity of the isolated RNA was checked using a nanodrop spectrophotometer and running the RNA on a 2% agar gel. 16S PCR using the universal primers was performed to check for DNA contamination in the RNA samples. cDNA conversion was achieved using the Prime ScriptTM 1st strand cDNA synthesis kit (TaKaRa) normalizing all samples by taking 1 µg of RNA. Primers for luxO (luxO-F- GCGAAAGTGGTACAGGTAAA, luxO-R-ATCAGATCTTTCGGAATGGC) and the housekeeping gene recA (recA-F-ATTGAAGGCGAAATGGGCGATAG, recA-R-TACACATACAGTTGGATTGCTTGAGG) were designed using Primer Premier 5 software. The reaction was normalized using the housekeeping gene recA. Also, the expression of the downstream target genes of LuxO, VpsA (VpsA-F-TTTTGGTGGTGGCTTTG, VpsA-R-ATTCGGATTGAGATGC),qrr-2 (qrr-2-F-GGTGACCCTTGTTAAGCCGA, qrr-2-R-CTATTCACTAACAACGTCAGTTGGC) and qrr-4 (qrr-4-F-TGACCCTTCTAAGCCGAGGG, qrr-4-R-GAACAATGGTGTTCACTAACAACG) were analysed. The hfq gene (hfq-F-CGGCATTAAACTGCAAGGTCA, hfq-R-CTGTGGTGGCTAACTGGACG) was used as the endogenous control to validate the expression of the regulatory RNAs. PCR amplification was done using an iCycler (Bio-Rad). The reaction procedure comprised of incubation at 95 °C for 10 min followed by 40 cycles of 95 °C for 10 s, 49 °C for 15 s and 60 °C for 45 s. Relative expression values were calculated as 2-Δ(CT Target-CT reference), where CT is the fractional threshold cycle.
Lactobacillus casei suppresses hfq gene expression in Escherichia coli O157:H7
Published in British Journal of Biomedical Science, 2019
Enterohaemorrhagic Escherichia coli O157:H7 is a zoonotic food and waterborne bacterial pathogen that causes a high hospitalization rate and life-threatening complications including seizures, cerebral oedema, haemolytic-uremic syndrome (HUS) and/or coma. The mortality associated with enterohaemorrhagic E. coli infections is due to the production and release of a Shiga toxin (Stx) by these bacteria [1]. The main regulator of this virulence gene is hfq, a bacterial RNA chaperone involved in virulence of an increasing number of bacterial pathogens [2]. A complex intestinal microflora provides protection against colonization by many pathogenic infectious agents. It has been hypothesized that foods fermented by lactobacilli help maintain a balance between lactobacilli and the indigenous intestinal flora [3]. The presence of lactobacilli in the gastrointestinal tract may suppress the growth of putrefactive and non-acid tolerant types of bacteria, thus reducing the amount of toxic substances generated [4]. Antimicrobial activity has been reported by co-culturing the symbiotic bacteria and pathogens in many studies. Bacteriocin-producing Lactobacillus spp provides protection against E. coli invasion during transit through in a dynamic model of the human stomach and small intestine [5]. Studies carried out both in culture media and foods have shown that bacteriocins produced by certain Lactobacillus spp can act synergistically antimicrobial activity [6]. Interestingly, Lactobacillus spp may simultaneously secrete organic acids and bacteriocins. Some studies have shown Lactobacillus spp to possess inhibitory activity towards the growth of pathogenic bacteria such as E. coli [7], but the changes in virulence genes by Lactobacillus spp against pathogens have not been studied yet. We hypothesized that Lactobacillus casei would exert a beneficial effect on E. coli by decreasing the virulence activity and growth rate of the latter.