China
Africa
Explore chapters and articles related to this topic
Order Piccovirales
Published in Paul Pumpens, Peter Pushko, Philippe Le Mercier, Virus-Like Particles, 2022
Paul Pumpens, Peter Pushko, Philippe Le Mercier
The presentation of foreign epitopes on the AAV2 VLPs was started with the Flag tag fusion to the N-terminus of VP3 and formation of the mosaic VLPs from wild-type VP2 and modified VP3 in insect cells, where the chimeric VLPs, however, were not recognized by anti-Flag antibody (Hoque et al. 1999). Furthermore, the relatively large proteins were incorporated into the AAV virions via N-terminal fusion to VP2 without compromising viral infectivity or affecting viral tropism (Warrington et al. 2004; Lux et al. 2005; Asokan et al. 2008; Münch et al. 2013). Rybniker et al. (2012) displayed a target antigen Ag85A of Mycobacterium tuberculosis, without its mycobacterial leader peptide sequence, by fusion to the N-terminus of the AAV2 VP2 protein and expression in mammalian cells. This study clearly demonstrated that the combination of antigen incorporation with antigen overexpression after cell transduction can dramatically enhance the antigenic potential of AAV-based vaccines (Rybniker et al. 2012). The human papillomavirus (HPV) epitopes were displayed on the AAV2 VLPs and demonstrated protective immunity after vaccination of mice and rabbits with the HPV16 and HPV31 L2 aa 17–36 stretch inserted at positions 587 and 453 of the AAV2 VP3, respectively (Nieto et al. 2012; Jagu et al. 2015). The exhaustive evaluation of the antigen-displaying AAV VLPs as future candidates for personalized cancer vaccination was recently performed by Neukirch (2021).
Non-VLPs
Published in Paul Pumpens, Single-Stranded RNA Phages, 2020
As Lee BH et al. (2016) stated in this excellent review, while the TRICK technique provided information on the first round of mRNA translation, four independent groups (Morisaki et al. 2016; Wang C et al. 2016; Wu B et al. 2016; Yan et al. 2016) have demonstrated two-color imaging of mRNA and its nascent polypeptides. These four studies used the MS2 or PP7 systems to label mRNA and the SunTag (Tanenbaum et al. 2014; Pichon et al. 2016) or FLAG tag (Viswanathan et al. 2015) systems to label nascent proteins. The fluorescence-tagged MS2 or PP7 capsid proteins were expressed in cells, providing a strong fluorescence signal from each mRNA. The SunTag and FLAG tag systems used fluorescently labeled antibody fragments that bound to multiple copies of a short epitope on each polypeptide. An mRNA undergoing active translation was identified by the colocalization of two fluorescent signals from the mRNA and nascent proteins.
Use of Enzymes in the Downstream Processing of Biopharmaceuticals
Published in Peter Grunwald, Pharmaceutical Biocatalysis, 2019
A specific application where enzymes are used to modify the structure of a precursor of the target molecule is the removal of affinity tags (Arnau et al., 2006; Waugh, 2011). These tags, which are usually composed of a number of exogenous amino acid sequences, are added by inserting the corresponding coding sequences next to those that code for the protein of interest. Tags that have a high affinity for a specific ligand like the common hexa-histidine (HHHHHH) tag (Hoffmann and Roeder, 1991) or that contain an epitope recognized by immobilized antibodies like the FLAG (DYKDDDDK) (Hopp et al., 1988; Knappik and Pluckthun, 1994) and Streptag II (WSHPQFEK) (Skerra and Schmidt, 2000; Schmidt and Skerra, 2007) tags, are commonly used to facilitate purification. The high affinity of the corresponding tag-protein fusions to their ligands makes it possible to purify them by affinity chromatography with immobilized nickel (His tag), antibody (FLAG tag) and streptavidin (Streptag II) matrices (Arnau et al., 2006; Unal et al., 2008). In other cases, tags like glutathione S-transferase (GST) (Ren et al., 2003), maltose binding protein (MBP) (Guan et al., 1988) and elastin-like polypeptides (ELP) (Kowalczyk et al., 2014) are introduced to improve the solubility of the target protein. Proteins fused with these tags are also easier to purify due to their ability to bind to specific matrices (e.g., glutathione–Sepharose for GST, amylose for MBP) or to undergo temperature-induced aggregation (ELPs) (Arnau et al., 2006).
GRP75 as a functional element of cholix transcytosis
Published in Tissue Barriers, 2023
Keyi Liu, Tom Hunter, Alistair Taverner, Kevin Yin, Julia MacKay, Kate Colebrook, Morgan Correia, Amandine Rapp, Randall J. Mrsny
96-well Costar plates (Corning, Corning Life Sciences B.V., Amsterdam, The Netherlands) were coated with ntChx and blocked with 3% BSA. Potential interacting molecules were added, following dilution into 3% BSA, to wells and incubated for 1 h at RT. Captured ntChx-TRIPs events were detected using specific antibodies in an ELISA microplate reader format where detection was determined by enzymatic reactions read at 405 nm (Bio-Rad). For interactions between GRP75 or other HSPs and ntChx, 96-well Costar plates were coated with ntChx or potential interacting molecule PBS. After blocking with 3%BSA, GRP75 or other HSPs were added to wells and incubated for 1 h at RT. The captured HSPs were detected using a specific anti-HSP Ab. Interaction studies using were performed similarly for Chx266-hGH or an equal molar concentration of hGH (to serve as a control) in PBS. Wells were blocked in 3% BSA. Flag-tag-labeled versions of test proteins (Origene Technologies, Inc., Rockville, MD) at 2 μg/ml in 3% BSA (pH 5.5 or pH 7.5) were then incubated for 1 h at RT. Wells coated with 3% BSA without proteins served as an additional control. The captured test proteins were detected using anti-Flag mAb (Origene Technologies, Inc). All ELISA plates were run in triplicate.
MEK/ERK/RUNX2 Pathway-Mediated IL-11 Autocrine Promotes the Activation of Müller Glial Cells during Diabetic Retinopathy
Published in Current Eye Research, 2022
Na Ji, Yang Guo, Songbai Liu, Manhui Zhu, Yuanyuan Tu, Jiahui Du, Xiaoxiao Wang, Ying Wang, E. Song
The human Müller cell line Moorfields/Institute of Ophthalmology-Müller 1 (MIO-M1) obtained from the University College London (UCL) Institute of Ophthalmology, London, UK,17 was cultured in DMEM L-Glutamax (Gibco, USA) with 5% fetal bovine serum (FBS). MIO-M1 cells cultured in 5 mM glucose for 24 h were taken as normal glucose (NG) groups; 30 mM glucose was taken as high glucose (HG) groups. Flag-tag RUNX2 or Flag-tag RUNX2DN (dominant-negative; missing exon8) was subcloned into the pShuttle vector (16402, Addgene, USA) before restriction enzyme cloning into the Adeno-X adenoviral vector (631513, Takara, Japan).18 MIO-M1 cells were divided into groups of NG, HG, HG + PBS (10 μL for 24 h), HG + U0126 (MEK inhibitor; S1102, Selleck, USA; 10 mM for 24 h), HG + LY294002 (ERK inhibitor; LY294002, Selleck; 20 μM for 24 h), HG + dominant-negative RUNX2 adenovirus (DN-RUNX2; at the MOI of 50 for the last 2 h) infection, HG + IL-11 neutralizing antibody (MAB218, R&D Systems; 15 μg/mL for 24 h) and HG + IL-11RA neutralizing antibody (MAB19771, R&D System; 10 μg/mL for 24 h).
Production of active human FGF21 using tobacco mosaic virus-based transient expression system
Published in Growth Factors, 2021
Jieying Fan, Yunpeng Wang, Shuang Huang, Shaochen Xing, Zhengyi Wei
Fragment of smGFP gene were amplified by PCR from vector pXW-Ms01 (Wei et al. 2011), with GFPF (CTAGTTAATTAATGGCAAGTAAAGGAGAAGAAC) and GFPR (CTAGCCTAGGTTATTTGTATAGTTCATCCATGCCATG) primers. The Pac I and Avr II sites were underlined in primers. After cleavage by the enzymes, the amplified products were inserted into tobacco transient expression vector pSK101 (Kagale et al. 2012) digested by the same enzyme to obtain pTTEV-smGFP construct. The human FGF21 gene encoding sequence was optimised in accordance with the preference of the tobacco codon, and the His-FLAG tag coding sequence was added to the 5′-end of the human FGF21 gene, which was then synthesised and inserted into the pUC57 vector to obtain pUC57-rhFGF21. The rhFGF21 was amplified from pUC57-rhFGF21 using the TransStart Fast Pfu DNA Polymerase. The amplicons were digested with Pac I and Avr II enzymes and ligated to the tobacco transient expression vector pSK101, which digested with the same enzymes, to obtain the pTTEV-rhFGF21 construct. The PCR primers were FGF21F (CTAGTTAATTAACGATGATGATTCGGAGGC) and FGF21R (CTAGCCTAGGACACTATGCGTTATCGTACG). pTTEV-smGFP and pTTEV-rhFGF21 were then transfected into Agrobacterium tumefaciens strain EHA105 using the freeze-thaw method.