China
Africa
Explore chapters and articles related to this topic
Monographs of Topical Drugs that Have Caused Contact Allergy/Allergic Contact Dermatitis
Published in Anton C. de Groot, Monographs in Contact Allergy, 2021
Penicillin is the generic name of the whole group of natural and semi-synthetic penicillins. Penicillin was originally obtained from the fungus Penicillium chrysogenum (old name: Penicillium notatum) and was discovered in 1928 by Sir Alexander Fleming, a Scottish researcher. All penicillins contain 6-aminopenicillanic acid with a side chain attached to the 6-amino group, which determines many of the antibacterial and pharmacological characteristics. As this is a historical topical allergen, the subject, of which there is abundant (often early) literature, will be discussed only very briefly.
Biocatalysts: The Different Classes and Applications for Synthesis of APIs
Published in Peter Grunwald, Pharmaceutical Biocatalysis, 2019
Penicillium chrysogenum is a β-lactam antibiotics producing industrial microorganism. McLean et al. (2015) metabolically reprogrammed this strain for the synthesis of pravastatin in that they deleted all penicillin biosynthetic genes and introduced the complete compactin gene cluster from Penicillium citrinum. As the modified P. chrysogenum produced higher amounts of compactin lacking the methylbutyrate side chain, the responsible esterase activity was deleted. In addition a new cytochrome P450 (P450 or CYP) from Amycolatopsis orientalis fused to the reductase domain of self-sufficient P450 RhF from Rhodococcus sp. (Nodate et al., 2006) was expressed in the β-lactam–negative P. chrysogenum so that this variant could serve as a platform for pravastatin production through hydroxylating compactin. However, it turned out that the wrong stereoisomer 6-epi-pravastatin was produced almost exclusively. Mutating the CYP105AS1 by error-prone PCR (introduction of active site as well as outer shell mutations) finally resulted in a pravastatin producer yielding more than 6 g/L of this drug. (For recombinant human cytochrome P450 monooxygenases and drug metabolite synthesis, see Schroer et al., 2010).
On Biocatalysis as Resourceful Methodology for Complex Syntheses: Selective Catalysis, Cascades and Biosynthesis
Published in Peter Grunwald, Pharmaceutical Biocatalysis, 2019
Andreas Sebastian Klein, Thomas Classen, Jörg Pietruszka
Phenoxymethylpenicillin (27a, penicillin V) is produced—like penicillin G (27b)—fermentative in the fungus Penicillium chrysogenum. By the supplementation of phenoxyacetate first the activated CoA-thioester 37 is formed, which competes with the natural precursor benzoyl-CoA (38) (Fig. 21.15). At high substrate concentrations, penicillin V (27a) is predominantly produced. Due to a higher acid stability, penicillin V (27a) can be given orally compared to penicillin G (27b). Penicillin V (27a) is specifically used for the treatment of bacterial infections, like streptococcal pharyngitis (strep throat), caused only by Gram-positive species. It is further less active against Gram-negative bacteria than penicillin G (27b).
Therapeutic manipulation of gut microbiota by polysaccharides of Wolfiporia cocos reveals the contribution of the gut fungi-induced PGE2 to alcoholic hepatic steatosis
Published in Gut Microbes, 2020
Shanshan Sun, Kai Wang, Li Sun, Baosong Cheng, Shanshan Qiao, Huanqin Dai, Wenyu Shi, Juncai Ma, Hongwei Liu
Direct ITS analysis was performed for fungal species isolates. The ITS1 (TCCGTAGGTGAACCTGCGG) and TIS4 (TCCTCCGCTTATTGATATGC) primers were used for PCR and sequencing. The fungus was identified on the basis of morphology and the DNA sequences of the ITS regions of their ribosomal RNA gene. Analysis of sequences showed homology with that of Meyerozyma guilliermondii (99.64%, accession number: KP675394.1), Penicillium chrysogenum (100%, accession number: MH151126.1), Penicillium citrinum (100%, accession number: KU216720.1), Rhodotorula mucilaginosa (99.65%, accession number: KP960512.1), Cystobasidium slooffiae (99.64%, accession number: MK386939.1), and Fusarium equiseti (99.21%, accession number: KY426410.1) in GenBank.
Alcohol use disorder and risk of sensitization to environmental allergens in Sub-Continental Asian Indian males
Published in Journal of Addictive Diseases, 2018
Yashwant Kumar, PVM Laxmi, Ranjana Walker Minz, Arnab Pal
In a cross-sectional study, 100 volunteers from the general population of Chandigarh city located in the Northwest region of India were recruited. The investigators visited households within the health care area of School of Public Health, Post Graduate Institute of Medical Education and Research. The volunteers consuming alcohol regularly for at least 6 months and fulfilling at least 2 of 11 criteria recommended by “Diagnostic and Statistical Manual of Mental Disorders, 5th edition” for a diagnosis of AUD were selected by the process of simple randomization. A medical/research officer offered all the participants a predesigned questionnaire including 10 point Alcohol Use Disorders Identification Test (AUDIT) score sheet that followed an interview. Information related to age at the onset of alcohol consumption, duration, and severity of AUD, confounding factors like dietary and smoking habits, parasitic and other infections particularly of the respiratory tract, associated co-morbidities and any sign and symptoms of allergy was collected. AUDIT score was calculated to assess the physical dependency. Thereafter, tIgE and allergen-specific IgE (spIgE) levels were measured in serum samples using an immunoassay analyzer (Phadia 100; Thermofisher Scientific, Sweden) and ready to use reagents and kits. The spIgE was measured against a battery of respiratory allergens grouped together as house dust (dust mite and cockroach), molds (Penicillium chrysogenum, Cladosporium herbarum, Aspergillus fumigatus, Alternaria alternata), trees (Mountain juniper, Oak, Elm, Cottonwood, Mesquite), and weeds (Ragweed, Mugwort, Plantain, Goosefoot, Saltwort). The cutoff value for tIgE was ≥100 IU/ml, and individuals with spIgE levels >0.35 IU were labeled as positive. Liver enzymes, e.g., aspartate transaminase (AST), alanine transaminase (ALT), alkaline phosphatase, and albumin levels were also analyzed to evaluate alcohol-induced liver damage, if any.
Advances in green synthesis of nanoparticles
Published in Artificial Cells, Nanomedicine, and Biotechnology, 2019
Aman Gour, Narendra Kumar Jain
Silver and Au NPs have been broadly considered for use in applications in a different scope of fields (e.g. optoelectronics, catalysis, sensing, medicine, etc.). Honey can increase the reduction speed as the concentration is increased in the NPs solution, NPs formed with the mediation of honey are having special characteristics such as bio-sensing, anticorrosive, catalytic and antimicrobial activity [50]. Francis et al. prepared Au and Ag NPs using M. glabrata leaf extract from their respective metal salt precursors by MW assistance. They open a new area for water purification because of their tremendous antimicrobial activity inhibiting pathogenic microorganisms like Bacillus pumilus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus niger and Penicillium chrysogenum [51]. An economic method was developed to synthesize Ag NPs of smaller then 140 nm sizes by using two different microorganisms Bacilus subtilus 10833 and Bacilus amylococus 1853, problem with this method was lake of reproducibility, time consuming process (48 h) and impurity issue at some extent [52]. Shen et al. revealed an investigation in which they reported combination of Au NPs from various microorganisms. They compared three different cell free extracts, i.e. bacteria Labrys sp., yeast Trichosporon montevideense, and filamentous fungus Aspergillus sp., selected for AuNPs and at the end of experiment they reported the average sizes of the NPs were 18.8, 22.2 and 9.5 nm, respectively. They found that the fungus showed better results as compared to others [53]. Gonnelli et al. described gold NPs (AuNPs) from concentrates of Cucurbitapepo L. takes off. The examination was completed at various plant ages, from one to four months, and the generation of NPs (in term of size, shape and yield) was dependent on the concentration of chlorophyll and carotenoids in the extracts [46]. A green combination of Ag NPs was created, utilizing a low-toxic system of microemulsion and nanoemulsion with castor oil as the oily phase, Brij 96V and 1,2-hexanediol as the surfactant and co-surfactant individually. Geranium (P. hortorum) leaf aqueous extract was utilized as a reducing specialist [54].