China
Africa
Explore chapters and articles related to this topic
Protein Subunit Vaccines and Recombinant DNA Technology
Published in F. Y. Liew, Vaccination Strategies of Tropical Diseases, 2017
E. coli can be grown in shake-flask cultures or fermenters, usually in minimal medium supplemented with casamino acids and glucose. The culture is then induced to express the recombinant protein during early exponential phase by addition of an inducer. In the case of the lac or tac promoter the inducer isopropyl β-d-thiogalactopyranoside is used and with the trp promoter indole-acrylic acid is used. Both inducers mimic the natural induction situation. The culture is then allowed to grow for a number of hours and the cells are harvested. In the author’s laboratory a standarized shake-flask expression analysis system has been developed which allows the following parameters to be investigated: (1) pulsed incorporation of radiolabeled amino acid into newly synthesized protein (this measures the inducibility and strength of the promoter; in very high expression some promoters can be leaky and can cause problems if the protein is toxic to the cell), (2) measurement of the percentage total cell protein as recombinant product, by scanning densitometry of coomassiestained SDS-polyacrylamide gels, (3) measurement of the apparent half-life of the recombinant protein, (4) determination of solubility or insolubility, (5) checking of plasmid copy number and structural integrity, (6) examination of cellular morphology, and (7) antigenicity or activity in crude extracts using immunoprecipitation and western blotting.
Live P. aeruginosa as a Cancer Vaccine Vector
Published in Ananda M. Chakrabarty, Arsénio M. Fialho, Microbial Infections and Cancer Therapy, 2019
Y. Wang, B. Polack, B. Toussaint
We then tackled the problem of T3SS activity variation from experiment to experiment. Indeed, the T3SS is activated during the exponential phase of growth but can attain a noninducible phenotype. This bistability, as suggested by the presence of a positive feedback circuit in the regulatory network controlling T3SS expression, may be due to an epigenetic switch allowing heritable phenotypic modifications. Using the generalized logical method, we designed a minimal model of the T3SS regulatory network that could support the epigenetic hypothesis and studied its dynamics, which helped to define a discriminating experimental scenario sufficient to validate the epigenetic hypothesis. A mathematical framework based on formal methods from computer science allowed a rigorous validation and certification of parameters of this model leading to epigenetic behavior. Experiments suggested by the formal method require pulsing ExsA by application of an external stimulus and observing the change in phenotype and its stability when the stimulus is removed. To pulse ExsA, we added an additional exsA gene, under the control of an inducible promoter, to a noninducible P. aeruginosa strain. In the construction, transcription of exsA is under the control of the ptac promoter repressed by the LacI protein produced in large amounts because of the presence of the laciq gene. Under inducing conditions, transcriptional repression by LacI is inhibited, permitting overexpression of the exsA gene from the ptac promoter. This induction is immediately released when the medium of the inducer is depleted. Using this approach, we demonstrated that a noninducible strain of P. aeruginosa can stably acquire the capacity to be induced by calcium depletion for the T3SS after a short pulse of the regulatory protein. Finally, the increased cytotoxicity of a strain after this epigenetic switch was demonstrated in vivo in an acute pulmonary infection model. Therefore, with the constructed plasmid we designed a sort of remote control of the T3SS in P. aeruginosa [12, 13].
High-sugar, high-fat, and high-protein diets promote antibiotic resistance gene spreading in the mouse intestinal microbiota
Published in Gut Microbes, 2022
Rong Tan, Min Jin, Yifan Shao, Jing Yin, Haibei Li, Tianjiao Chen, Danyang Shi, Shuqing Zhou, Junwen Li, Dong Yang
The donor bacterium (MEC-5) isolated from mouse feces was identified as Escherichia coli. Donor strains were chromosomally tagged with mCherry encoding constitutive red fluorescence and the tac promoter expressing mCherry was encoded upstream.55 In addition, RP4 plasmids harboring tetracycline (tet) and kanamycin (km) resistance genes were appended to a genetically encoded expressible green fluorescent protein (GFP) gene. Next, MEC-5-mCherry was electroporated with the plasmid RP4-GFP-TetRKmR. As a result, both red and green fluorescence occurs in donor cells, but upon plasmid transfer to a fecal bacterium, the transconjugants display green fluorescence due to GFP expression, which can be detected and sorted by fluorescence microscopy or fluorescent-activated cell sorting (Supplementary File S1).
Helicobacter pylori PqqE is a new virulence factor that cleaves junctional adhesion molecule A and disrupts gastric epithelial integrity
Published in Gut Microbes, 2021
Miguel S. Marques, Ana C. Costa, Hugo Osório, Marta L. Pinto, Sandra Relvas, Mário Dinis-Ribeiro, Fátima Carneiro, Marina Leite, Ceu Figueiredo
The expression vector pGEX-6P-2 (GE Healthcare) was engineered to co-express HP1012 and HP0657, each with a different tag. To the original vector backbone, a synthetic 109-nucleotide sequence containing a Tac promoter, a ribosome binding site, a sequence of six histidines, and a new SacI restriction site was added (TGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGGGCAGCAGCCATCACCATCATCACCACAGCCA, Sigma), followed by the original EagI restriction sequence. The 109 ssDNA sample was converted to dsDNA by PCR, double-digested with SacI and EagI, and introduced into pGEX-6P-2. (The new vector was named pGEX_His.) All vectors used for protein expression are listed in Supplementary Table S8. For cloning and expression, HP1012 and HP0657 genes were amplified from the genomic DNA of H. pylori 26695, and the PCR products and the plasmid were digested with EcoRI and XhoI or with SacI and EagI (New England Biolabs). All primers used for cloning and sequencing are listed in Supplementary Table S7. Ligation of the PCR products with the pGEX-His plasmid was performed following the instructions for the Quick Ligation™ Kit (New England Biolabs). E. coli strain BL21 (DE3) (NZYtech) was transformed and plated on a Luria Broth Agar medium supplemented with 100 µg/mL of ampicillin (NZYtech). Transformants were selected upon overnight incubation at 37°C. Plasmid extraction was performed using the NZYMiniprep kit (NZYtech) following the manufacturer’s instructions.
Microcin MccI47 selectively inhibits enteric bacteria and reduces carbapenem-resistant Klebsiella pneumoniae colonization in vivo when administered via an engineered live biotherapeutic
Published in Gut Microbes, 2022
Benedikt M. Mortzfeld, Jacob D. Palmer, Shakti K. Bhattarai, Haley L. Dupre, Regino Mercado-Lubio, Mark W. Silby, Corinna Bang, Beth A. McCormick, Vanni Bucci
This study used the Escherichia coli strains NEB10β (New England Biolabs, Ipswich, MA), Nissle 1917 as well as all strains listed in Table 1. Strains in Table 1 were purchased from ATCC (Manassas, VA). All plasmids in this study have been transformed into cells using electroporation with the Bio-Rad MicropulserTM (Bio-Rad Laboratories, Hercules, CA) and were created using Gibson Assembly51 using the Gibson Assembly Master Mix (New England Biolabs, Ipswich, MA) and custom DNA oligonucleotides purchased from Integrated DNA Technologies (Coralville, IA). For pBBAD-H47 and pBBAD-I47, four fragments were amplified by PCR and assembled: (1) linearized pUC19, (2) araC and PBAD from pTARA52 (Addgene #39491), (3) the microcin and immunity genes for MccH47 (mchXIB) or MccI47 (mciIA) originating from pEX200053 as well as (4) the genes mchCDEFA originating from pPP2000.20 Plasmid pHMT-H47 has been described and used in.20 For plasmid pHMT-I47 a total of seven fragments was assembled: (1) linearized pUC19, (2) chloramphenicol resistance cassette from pTARA52 (Addgene #39491), (3) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA), (4) MBP, amplified using primers to add a 6× Histidine N-terminal tag, from pMAL-c5X, (5) mciA from pEX2000,53 (6) mciI from pEX2000, and (7) mchCDEFA from pPP2000. To cure the native pMut2 plasmid from E. coli Nissle 1917, pCure2-I47 was assembled from four fragment: (1) linearized pMut2, (2) chloramphenicol resistance cassette from pTARA52 (Addgene #39491), (3) mciA from pEX2000,53 (4) lacI and tac promoter from pMAL-c5X (New England Biolabs, Ipswich, MA). The modified replacement plasmid for pMut2, pMut2-I47, was created from four fragments: (1) linearized pMut2, (2) ampicillin resistance cassette from pUC19, (3) insulated promoter proD,37 where the promoter region was replaced with the strong constitutive promoter J23119 (BBa_J23119), (4) mciIA to mchCDEFA from pBBAD-I47. All plasmid sequences and maps have been deposited as .dna files at: https://gitlab.com/vanni-bucci/2021_MccI47_paper. Chromosomal modifications were obtained through lambda Red recombination using pKD46 and FLP-FRT recombination using pCP20 as described by Datsenko and Wanner.54 Briefly, a kanamycin resistance cassette flanked by flippase recognition target (FRT) sites was amplified by PCR from pKD4 and then transformed into the respective electrocompetent EcN strain harboring plasmid pKD46. For strain EcNΔH ΔM, the kanamycin resistance was removed after the knockout of mchIB by inducing the flippase from pKD20, before it was reintroduced for the mcmIA knockout. All modifications were confirmed using Sanger sequencing (Figure S3).