China
Africa
Explore chapters and articles related to this topic
Molecular adaptation to resistance exercise
Published in Adam P. Sharples, James P. Morton, Henning Wackerhage, Molecular Exercise Physiology, 2022
Beyond the acute regulation of the activity of the ribosome (the amount of protein synthesized per mRNA), mTORC1 can also regulate the number of ribosomes, or the translational capacity of the cell. mTORC1 regulates ribosome mass through the phosphorylation of a key ribosomal RNA transcription factor (upstream binding factor; UBF) and the preferential translation of ribosomal proteins. The transcription of ribosomal DNA is so essential to the function of cells that it has a specialized RNA polymerase (POL I) whose only role is to translate rDNA into the 47S pre-ribosomal RNA. The polycistronic 47S rRNA is then cleaved into the mature 5, 5.8, 18 and 28S rRNAs that make up ~80% of all the RNA in a mammalian cell (53). The transcription of rDNA is thought to be the first step in ribosome biogenesis (the production of new ribosomes) and this process is regulated by the protooncogene myc, and the transcription factors SL1 and UBF. Important for the regulation of ribosome biogenesis in response to resistance exercise, myc transcription increases, and the transcriptional activity of UBF is increased in response to phosphorylation by S6K1. In fact, activation of S6K1 is enough to drive ribosome biogenesis (54). So, following resistance exercise, UBF phosphorylation increases in relation to increased ribosomal RNA synthesis (52).
Trichosporon
Published in Rossana de Aguiar Cordeiro, Pocket Guide to Mycological Diagnosis, 2019
João Nobrega de Almeida Júnior
Sequence analysis of the intergenic spacer from the ribosomal DNA with the primers 26S (5′-ATCCTTTGCAGACGACTTGA-3′) and 5SR (5′-AGCTTGACTTCGCAGATCGG-3′) is the gold-standard method for species identification (Sugita et al., 2002). Some closely related species like T. asteroides and T. japonicum are only differentiated by a single nucleotide polymorphism (Sugita et al., 2002).
rDNA: Evolution Over a Billion Years
Published in S. K. Dutta, DNA Systematics, 2019
The rRNA genes of wheat (T. aestivum cv. Chinese Spring) are located mainly on chromosomes 1B and 6B with a minor site located on chromosome 5D81,82 (Figure 5). Although the rDNA is located in the distal one half to one third of the respective chromosomes, the genetic distance (determined by recombination frequency of the rDNA) from the centromere is very small (6B examined in detail83). Estimates for the numbers of rRNA genes on chromosome 1B range from 1300 to 1500, 6B from 500 to 3000, and 5D from 130 to 400 depending on the wheat variety considered.84,438 In T. aestivum cv. Chinese Spring there are no detectable rRNA genes on chromosome 1A,81 although in T. aestivim ssp. spelta this chromosome is a major location for rRNA genes.85 Quantitative variation in rRNA gene numbers in wheat and related grasses is also evident from heterozygosity observed in situ hybridization experiments using radioactive probes, where grain counts consistently indicate differences between homologous sites.85 Within the genus Triticum, most diploid and tetraploid species have two chromosomal locations for rDNA,86,89 and in specific cases such as T. araraticum,90T. dicoccoides,91 and T. speltoides92 these sites have been designated 1B and 6B. The homologous group 5 chromosomes also carry ribosomal DNA in some diploid Triticum species.89,92 Among hexaploid wheats as many as four chromosomal locations have been found.87
Activation of AMPK-PGC-1α pathway ameliorates peritoneal dialysis related peritoneal fibrosis in mice by enhancing mitochondrial biogenesis
Published in Renal Failure, 2022
Jun Wu, Jushuang Li, Baohong Feng, Zhimin Bi, Geli Zhu, Yanxia Zhang, Xiangyou Li
The visceral peritoneal membrane (mesentery tissue 50 mg) was collected. Total DNA was isolated from peritoneal tissue using the DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer’s instructions. Total RNA was extracted from peritoneal tissue with TRIzol reagent according to the manufacturer’s instructions. Real-time polymerase chain reaction (RT–PCR) was performed using the ABI 7900HT sequence detection system (Applied Biosystems). The following primers were used. GGCCTGACTGGCATTGTATT (forward) and TGGCGTAGGTTTGGTCTAGG (reverse) for mitochondrial DNA-encoded cytochrome c oxidase subunit I (COX I), GCCGACTAAATCAAGCAACA (forward) and CAATGGGCATAAAGCTATGG (reverse) for COX II, TAGAGGGACAAGTGGCGTTC (forward) and CGCTGAGCCAGTCAGTGT (reverse) for nucleus-encoded 18S ribosomal DNA(18S rDNA). CAATTGAAGAGCGCCGTGT (forward) and CCATCATCCCGCAGATTTAC (reverse) for PGC-1α and GGGAAACTGTGGCGTGAT (forward) and GAGTGGGTGTCGCTGTTGA (reverse) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Data were analyzed using the 2−ΔΔCt method. The relative mitochondrial copy number was evaluated by calculating the ratio of COX I or COX II to 18S rDNA.
Nucleophosmin 1: from its pathogenic role to a tantalizing therapeutic target in acute myeloid leukemia
Published in Hematology, 2022
Yuye Shi, Yuhao Xue, Chunling Wang, Liang Yu
These mutations lead to frameshift mutations in the CTD of NPM1, thus inserting a new NES or leading to loss of W288 and W290 (or W290 alone) in the original NLS, resulting in ectopic localization of NPM1 in the cytoplasm of leukemia cells (also known as NPM1c+) [30]. Polypeptides harboring NPM1mut have different kinetics and oligomerization levels and therefore have different abilities to form amyloid aggregates. Thus, like wild-type NPM1 (NPM1wt), NPM1mut may have a modulated function by regulation of oligomerization [7]. Moreover, NPM1-CTD bound with high-affinity G-quadruplex DNA regions found in ribosomal DNA, while NPM1 variants completely lost this activity, which is crucial for its nucleolar localization [31]. This suggests that the abnormal structure of NPM1mut might lead to its cytoplasmic localization. In addition, NPM1wt could also abnormally localize to the cytoplasm by forming a heterodimer with NPM1mut [32].
Identification of gut microbiome and transcriptome changes in ulcerative colitis and pouchitis
Published in Scandinavian Journal of Gastroenterology, 2022
Xin Gao, Di Huang, Li-Sheng Yang, An-Qi He, Kai-Yu Li, Tong Liu, Gang Liu
According to the OMEGA Stool DNA Kit instructions (D4015, Omega, Inc., Norwalk, CT), genomic DNA extraction from Stool samples was performed. The concentration and purity of DNA samples were determined by NanoDrop2000 spectrophotometer and unqualified DNA samples will be discarded. Primers for the 16S ribosomal DNA V3–V4 regions of the bacterial genome were designed in the experiment. The primer sequence of 336F was 5′-GTACTCCTACGGGAGGCAGCA-3′, and the primer sequence of 806R was 5′-GTGGACTACHVGGGTWTCTAAT-3′. A PCR system was established to specifically amplify the V3–V4 region of the 16S ribosomal DNA of the sample genome. Qualified agarose gels were sent to LC-Bio Technology (Hangzhou, China) for Miseq library construction then performed sequencing on Illumina Miseq PE300 platform.