China
Africa
Explore chapters and articles related to this topic
Inbred Laboratory Mice as Animal Models and Biomedical Tools: General Concepts
Published in John P. Sundberg, Handbook of Mouse Mutations with Skin and Hair Abnormalities, 2020
Laboratory mice have proven to be extraordinarily useful for biomedical research due to their small size, short breeding time, polytoceous nature, relatively low husbandry costs, and short life span. Inbreeding (20 generations of brother-sister matings) can essentially eliminate genetic variability between individuals of the same sex. Controlled environment and specific pathogen-free status of the animals further increases the repeatability of biological studies.
Determination of Antiviral Activity
Published in Adorjan Aszalos, Modern Analysis of Antibiotics, 2020
In vivo antiviral experiments may be highly dependent on the age, sex, species, and strain of animal employed in such studies. Older animals are often more resistant to the virus challenge than are younger animals, and the younger animals usually are less able to tolerate the administration of the substance being tested. Fighting tendencies of the male, especially as seen in the mouse, often influence the results of the experiment. The susceptibility to the challenge virus will vary markedly according to the species and strain of animal used and may influence the infection parameter to be chosen. Unless large supplies of test material are available to the investigator, however, attempts are usually made to use small animals, which would require relatively lesser quantities of that test substance. Many antiviral researchers tend to use designated specific pathogen-free animals to avoid the problem of animals that have a latent infection of some indigenous virus or are carrying specific antibodies to certain virus that often occur naturally in some animal colonies.
Surgical Facilities, Peri-Operative Care, Anesthesia, and Surgical Techniques
Published in Yuehuei H. An, Richard J. Friedman, Animal Models in Orthopaedic Research, 2020
Alison C. Smith, M. Michael Swindle
Reputable commercial vendors that supply specific pathogen free animals should be used as the source for rodents and rabbits. These suppliers routinely perform intensive health monitoring to document quality assurance and freedom from endogenous pathogens in their animals. Presence of endogenous viral or bacterial pathogens can be an important source of experimental variation in terms of an animal’s ability to undergo anesthesia, initiate and sustain normal tissue response to surgery, as well being free of a reservoir of bacteria that can potentially seed any bioimplants. Vendor health monitoring reports can be supplemented with in-house laboratory tests if vendor surveillance is desirable, however, generally no preoperative work-up is performed prior to surgery for these species.
B. adolescentis ameliorates chronic colitis by regulating Treg/Th2 response and gut microbiota remodeling
Published in Gut Microbes, 2021
Lina Fan, Yadong Qi, Siwen Qu, Xueqin Chen, Aiqing Li, Maher Hendi, Chaochao Xu, Lan Wang, Tongyao Hou, Jianmin Si, Shujie Chen
Male age-matched C57L/B6 mice (6 ~ 8 weeks of age) were purchased from Shanghai SLAC Laboratory Animal, China. All animals were kept under specific pathogen-free conditions. Before bacterial intragastric administration, mice were fed with 2 mg/ml streptomycin in the drinking water for 3 days to ensure the consistency of regular microbiota, then they were randomly assigned to three groups. Five days of 3% DSS administration followed by 7 days of normal water, this process repeated for three cycles. Bacteria treatment was done after every DSS application. The bacteria were applied by oral gavage daily except when DSS was applied. Group B.a (DSS+B.a) mice were administrated 1 × 109 CFU of B. adolescentis suspended in 300 µl sterile anaerobic PBS by oral gavage, while mice in the group control (DSS+PBS) were given an equivalent volume of sterile anaerobic PBS instead. The last group, normal, was given regular water. The treatment was continued for 36 days. Body weight was recorded weekly. Colon and spleen tissues were then harvested after mice were fasted at the end of the experiment. Colon tissue was photographed and length measured, while spleen tissue was photographed and weighed.
Targeted silencing of genes related to acute monocytic leukaemia by CpG(B)-MLAA-34 siRNA conjugates
Published in Journal of Drug Targeting, 2020
Bingqiao Huang, Aili He, Pengyu Zhang, Xiaorong Ma, Yun Yang, Jianli Wang, Jin Wang, Wanggang Zhang
All animal experiments were performed in a specific pathogen free environment at the Air Force Military Medical University. Nude female mice, 6–8 weeks of age, were divided into five groups (15 mice/group): (1) non-tumour group; (2) untreated group; (3) CpG(B)-Luc siRNA group; (4) AG490 group; (5) CpG(B)-MLAA34 siRNA group. The last four groups (groups 2–5) of mice were injected via the tail vein with 1 × 106 THP-1 cells. After AML cells reached a blood concentration of 1–5%, nude mice became AML M5 mice. These mice were injected six times with CpG(B)-siRNAs (5 mg/kg), AG490 (90 nmol) or PBS, every other day, and euthanised by dislocation of cervical vertebra one day after the last treatment. The spleen and liver of mice were separated, measured and weighted. A part of spleen (1 cm × 1 cm × 0.5 cm) was cut and immersed in 10% formalin solution for haematoxylin and eosin/immunohistochemical staining. Other organs are frozen quickly by liquid nitrogen and stored in a refrigerator (–80 °C) for subsequent other experiments. All the experimental protocols were approved by the Committee on Animal Experimentation of Institutional Animal Care and were conducted under the Ethical Standards of the Air Force Military Medical University (20161017).
Blockade of TGF-β signaling with novel synthetic antibodies limits immune exclusion and improves chemotherapy response in metastatic ovarian cancer models
Published in OncoImmunology, 2019
Daniel Newsted, Sunandan Banerjee, Kathleen Watt, Sarah Nersesian, Peter Truesdell, Levi L. Blazer, Lia Cardarelli, Jarrett J. Adams, Sachdev S. Sidhu, Andrew W. Craig
Tumor nodules were prepared for cryosectioning, and frozen 20-μm sections were post-fixed in acetone and blocked for 1 hour with 3% bovine serum albumin prior to addition of primary antibodies overnight at 4°C. Sources and dilutions of primary antibodies were as follows: Alexa Fluor 488 rat anti-mouse FOXP3 (BioLegend, MF-14; 1:100) and rabbit anti-Granzyme B (Abcam, ab4059, 1:200). The detection antibody was Alexa Fluor 568-conjugated goat anti-rabbit secondary antibody (Molecular Probes, 1:200), and was incubated for 60 minutes at room temperature (DAPI was also included to detect cell nuclei, 1:400). Images were acquired by epifluorescence microscopy and analysis of FOXP3+ and Granzyme B+ cell density performed in Image J. Intra-tumoural gene expression by qRT-PCR was performed following tumour RNA extraction in TRIZOL according to the previous describe method. Primers (5ʹ-3ʹ) for CD8a: (Forward:CCGTTGACCCGCTTTCTGT, Reverse:TTCGGCGTCCATTTTCTTTGG) and CD45: (Forward:AAGAGTTGTGAGGCTGGCAC, Reverse:GCTCAAACTTCTGGCCTTTG). All animals were housed in a specific pathogen-free facility, and procedures were approved by the Queen’s University Animal Care Committee in accordance with the Canadian Council on Animal Care guidelines.