China
Africa
Explore chapters and articles related to this topic
Microbial Biofilm in Remediation of Environmental Contaminants from Wastewater
Published in Vineet Kumar, Vinod Kumar Garg, Sunil Kumar, Jayanta Kumar Biswas, Omics for Environmental Engineering and Microbiology Systems, 2023
Pallavi Singh, Akshita Maheshwari, Varsha Dharmesh, Vandana Anand, Jasvinder Kaur, Sonal Srivastava, Satish Kumar Verma, Suchi Srivastava
Next-generation sequencing is a revolutionized DNA sequencing technology, where sequencing by synthesis principle is applied. In NGS, sequencing of millions of small fragments of DNA occurs. This technology provides an insight into microbial ecology with exploration of deeper layers of communities of microbes and gives impartial outlook of diversities and composition of communities. The steps involved in NGS are (1) DNA extraction from the sample biofilms; (2) checking the extracted DNA’s purity and quantity using NanoDrop spectrophotometer; (3) PCR amplification of the samples using 16SrRNA gene along with universal primers, i.e. 28F and 519R, with the different barcodes incorporated between the forward primer and 454 adaptor; (4) PCR products which are purified are further used for pyrosequencing and then short adaptors are ligated to both ends for sequence segregation; (5) modified products are attached to the DNA beads; (6) clonal amplification; (7) pyrosequencing for 16S rRNA gene sequence, pre-processing at Ribosomal Database Project (RDP) for trimming of barcodes and primers are removed from the partial ribo tags along with discarding short and low-quality sequences; (8) generation of the FASTA file data sets; (9) analysis of these sequence through analysis pipeline (MOTHUR) and R-Scripts. The NGS technique has the potential utility in confirming the sequencing and removing the conventional technique of characterizing of microbes because it has the advantages of flexibility, accuracy, and easy automation (Ronaghi, 2001).
Current Use and Future Promise of Genetic Engineering
Published in Michael Hehenberger, Zhi Xia, Huanming Yang, Our Animal Connection, 2020
Michael Hehenberger, Zhi Xia, Huanming Yang
Another important genetic engineering technology that enabled the biotech revolution is DNA Sequencing. DNA sequencing technologies are used to determine the order of the nucleotide bases A, G, C, and T in a molecule of DNA. The first DNA sequences were obtained in the early 1970s by academic researchers. Early forms of nucleotide sequencing were based on chromatography, laboratory techniques for the separation of mixtures that were invented in 1900 by Michail Tsvet303 and first applied by him to the extraction of plant pigments such as chlorophyll and carotene. RNA sequencing was done first because it was easier to deal with a single strand of a helical molecule than working with the full double helix. Between 1972 and 1976, Walter Fiers and his coworkers at Ghent (Belgium) were able to sequence the first complete gene and the complete genome of a viral genome, “Bacteriophage MS2.”304 During the 1970s, Frederick Sanger at the Medical Research Council in Cambridge, UK, developed his method of “DNA sequencing with chain-terminating inhibitors,”305 and Walter Gilbert and Allan Maxam at Harvard in Cambridge, Massachusetts, developed “DNA sequencing by chemical degradation.”306 In 1980, Sanger and Gilbert shared one half of the Nobel Prize307 for their “contributions concerning the determination of base sequences in nucleic acids,” with Paul Berg of Stanford University capturing the other half for his “fundamental studies of the biochemistry of nucleic acids, with particular regard to recombinant-DNA,” as already covered above.
Current Use and Future Promise of Genetic Engineering
Published in Michael Hehenberger, Zhi Xia, Our Animal Connection, 2019
Another important genetic engineering technology that enabled the biotech revolution is DNA Sequencing. DNA sequencing technologies are used to determine the order of the nucleotide bases A, G, C, and T in a molecule of DNA. The first DNA sequences were obtained in the early 1970s by academic researchers. Early forms of nucleotide sequencing were based on chromatography, laboratory techniques for the separation of mixtures that were invented in 1900 by Michail Tsvet303 and first applied by him to the extraction of plant pigments such as chlorophyll and carotene. RNA sequencing was done first because it was easier to deal with a single strand of a helical molecule than working with the full double helix. Between 1972 and 1976, Walter Fiers and his coworkers at Ghent (Belgium) were able to sequence the first complete gene and the complete genome of a viral genome, “Bacteriophage MS2.”304 During the 1970s, Frederick Sanger at the Medical Research Council in Cambridge, UK, developed his method of “DNA sequencing with chain-terminating inhibitors,”305 and Walter Gilbert and Allan Maxam at Harvard in Cambridge, Massachusetts, developed “DNA sequencing by chemical degradation.”306 In 1980, Sanger and Gilbert shared one half of the Nobel Prize307 for their “contributions concerning the determination of base sequences in nucleic acids,” with Paul Berg of Stanford University capturing the other half for his “fundamental studies of the biochemistry of nucleic acids, with particular regard to recombinant-DNA,” as already covered above.
Advanced 5D logistic and DNA encoding for medical images
Published in The Imaging Science Journal, 2023
Bharti Ahuja, Rajesh Doriya, Sharad Salunke, Md. Farukh Hashmi, Aditya Gupta
The technique of mapping the nucleotide sequence comprising a DNA strand is termed ‘DNA sequencing’. The four bases that make up genetic coding are: adenine (A), thymine (T), guanine (G), and cytosine (C). ‘A’ binds with ‘T’ and ‘G’ binds with ‘C’ [39]. We understand that each pixel in a digital image can also be represented using 8-bit binary integers [40]. The complementary digital numbers of the pair 0–3 and 1–2 are used for the four deoxynucleotides ‘A,’ ‘T,’ ‘G,’ and ‘C’ and their combinations to express the digital numbers ‘00,’ ‘11,’ ‘01,’ and ‘10’. For instance, any pixel value of 206 can be expressed in the corresponding binary as ‘11001110’. This binary is ‘TATC’ in DNA coding with the above rules. The four nucleotides can be combined in 24 different ways. Only eight encoding permutations are, though, compatible with the complementary principle. Figure 5, illustrates and Table 1 summarizes these rules.
Synthesis of itaconic acid from agricultural waste using novel Aspergillus niveus
Published in Preparative Biochemistry and Biotechnology, 2018
Ramakrishnan Gnanasekaran, Balaji Dhandapani, Kannappan Panchamoorthy Gopinath, Jeyaraj Iyyappan
The identification of isolated fungal species was carried out by 18S rRNA sequencing. Genomic DNA was extracted from fungal according to the method described by Zhou et al. (2008).[10] DNA concentrations were measured by running aliquots on 1% agarose gel. Universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used for amplification of respective coding sequence. The reaction mixture (25 μL) of PCR cycle contained 1.5 μL of ITS1, 1.5 μL of ITS4, 5 μL of DNAse–RNase free water, and 12 μL of Taq Master Mix. The PCR amplification produces multiple copies of the target DNA sequence. The resulting product is used as the template for the sequencing. The amplification process was carried out at the temperature of 94 °C for ∼3 min (initial denaturation). Then, the process was continued nearly 30 cycles at the temperature of 94 °C for ∼30 s. Further, the annealing and extension step was performed at 60 °C for 30 s and 72 °C for 1 min, respectively. The final extension step was carried out at 72 °C for 10 min. DNA sequencing was done by the common Sanger sequencing method. The two strands of the DNA (3′–5′ and 5′–3′) are sequenced separately using the forward and reverse primers. After the sequencing process completion, the phylogenic tree was generated and the sequence was compared with others. The phylogenic tree was generated by using the bioinformatics tool. It is used to visualize the result of hierarchical clustering calculation.
A Chaotic Approach to Recognize the Characteristics of Genetic Codes of Covid Patients
Published in Computer Methods in Biomechanics and Biomedical Engineering: Imaging & Visualization, 2023
A cell is the basic scale of every living organism. By examining the gene expression, we can get information about some characteristics of the particular organism. In the examination of the gene expression process, the DNA sequence plays a vital role. DNA sequencing is the process of deciphering a strand of DNA nucleotide sequence (A, C, G, and T). The information needed by a cell to build protein and RNA molecules is included in the DNA base sequence. In short, it functions similarly to a switch that turns on or off protein synthesis. It also plays a key role in the determination of the molecular signature of diseases.