China
Africa
Explore chapters and articles related to this topic
Inflammatory Disorders of the Nervous System
Published in Philip B. Gorelick, Fernando D. Testai, Graeme J. Hankey, Joanna M. Wardlaw, Hankey's Clinical Neurology, 2020
Fingolimod was the first approved oral agent. It is a sphingosine-1-phosphate receptor blocker, and impedes the migration of CD4 T and B cells out of lymph nodes. It reduces RR by 50–55%, but it can cause cardiac rhythm problems, liver dysfunction, macular edema, pulmonary complications, and teratogenicity, together with PML in approximately 1/15,000 cases.
Lymphocyte trafficking from inductive sites to effector sites
Published in Phillip D. Smith, Richard S. Blumberg, Thomas T. MacDonald, Principles of Mucosal Immunology, 2020
Valerie Verhasselt, William Agace, Oliver Pabst, Andrew Stagg
In most cases, naive T cells will not find their cognate antigen:MHC on the surface of DCs and will leave the lymph nodes within a few hours via the efferent lymph. Depending on the particular situation, lymphocytes in lymph will directly reenter the circulation or enter the subcapsular region of higher-order lymph nodes. In contrast, if activated, T cells are initially retained within the lymph node, where they undergo rapid clonal expansion. A subset of these cells subsequently migrates via the efferent lymph back to the circulation, from where they can seed other organs. The underlying cellular and molecular mechanisms regulating the egress of lymphocytes from lymph nodes are only beginning to emerge. A key factor in the regulation of lymphocyte egress is the lysophospholipid sphingosine-1-phosphate (S1P). S1P concentrations are higher in blood and lymph than in lymph nodes, and these differential levels of S1P are needed to drive lymphocyte exit. S1P is produced by sphingosine kinases through the phosphorylation of sphingosine and is degraded by sphingosine lyase. Thus, S1P concentrations in tissues, lymph, and blood are regulated by the differential activity of the respective S1P-producing and/or -degrading enzymes as well as S1P release from intracellular stores. High S1P levels in lymph are maintained by the expression of sphingosine kinase in lymphatic endothelial cells, whereas high S1P concentrations in blood rely on S1P release from red blood cells.
Maturation, Barrier Function, Aging, and Breakdown of the Blood–Brain Barrier
Published in Shamim I. Ahmad, Aging: Exploring a Complex Phenomenon, 2017
Elizabeth de Lange, Ágnes Bajza, Péter Imre, Attila Csorba, László Dénes, Franciska Erdő
The metabolic turnover of sphingolipids produces several signaling molecules that profoundly affect the proliferation, differentiation, and death of cells. It is well known that specifically ceramide and sphingosine-1-phosphate play an important role in the so-called cell death pathways. A wide body of evidence indicates that ceramide and amyloid beta protein plays a key role in attacking mitochondria to set in the pathways of cell death in AD (Chakrabarti et al. 2016).
Assessing potential liver injury induced by Polygonum multiflorum using potential biomarkers via targeted sphingolipidomics
Published in Pharmaceutical Biology, 2022
Zhixin Jia, Lirong Liu, Jie Liu, Cong Fang, Mingxia Pan, Jingxuan Zhang, Yueting Li, Zhong Xian, Hongbin Xiao
Sphingolipid (SPL) play an important role in cell survival and death (Cuvillier et al. 1996) as well as the progression of liver diseases and hepatic dysfunction. Figure 1 shows the metabolic pathway of SPLs (Merrill et al. 2009; Lebesgue et al. 2017). Sphingosine could cause cell apoptosis and senescence, whereas sphingosine-1-phosphate (S1P) and ceramide-1-phosphate (C1P) promote cell growth and proliferation (Gómez-Muñoz 2006; Rodriguez-Cuenca et al. 2017). Moreover, the perturbations of plasma SPLs could be related to hepatocyte apoptosis and liver injury (Neumeyer et al. 2006). Apoptosis mediated by the mitochondria in liver cells could cause the accumulation of plasma ceramides (Cers) and a decrease in dihydroceramides (dhCers) (Stiban et al. 2006; Park et al. 2013; Pastore et al. 2015). Therefore, SPLs detection might be an applicable approach to detecting PM-induced liver injury.
Emerging drugs for the treatment of alopecia areata
Published in Expert Opinion on Emerging Drugs, 2022
Hassiel Aurelio Ramírez-Marín, Antonella Tosti
Sphingosine-1-phosphate (S1P) is a lipid metabolite that acts upon five different G-protein-coupled receptors (S1PR1-S1PR5), which are involved in lymphocyte/hematopoietic cell trafficking. An S1P gradient regulates lymphocyte migration to tissues [61]. S1RP1 modulators lead to degradation which causes lymphocytes to be incapable of following the S1P gradient to inflammation sites. S1P receptors antagonists are in development for multiple sclerosis, with five of them approved for its treatment (fingolimod, siponimod, ponesimod and ozanimod) [61]. Other immune diseases that could respond to these drugs include systemic lupus erythematosus, psoriasis, inflammatory bowel disease and rheumatoid arthritis. Possible side effects of S1PR modulators include leukopenia, anemia, transaminase elevation, macular edema, teratogenicity, pulmonary disorders, infections, and cardiovascular events [61].
Mycobacterium bovis BCG-mediated suppression of Th17 response in mouse experimental autoimmune encephalomyelitis
Published in Immunopharmacology and Immunotoxicology, 2021
Goro Matsuzaki, Naoko Teruya, Hideyasu Kiyohara Kohama, Keiko Arai, Yukihiro Shibuya, Yasushi Chuma, Kazuhiro Matsuo
The expression of sphingosine-1-phosphate receptor 1 (S1PR1) was analyzed by qPCR. In brief, RNA was extracted using TRIzol reagent (Thermo Fisher Scientific), reverse-transcribed with a reverse transcriptase (SuperScript VILO cDNA Synthesis Kit; Thermo Fisher Scientific), and amplified with Taq polymerase premixed with SYBR Green using the Step One Realtime PCR System (Thermo Fisher Scientific). The qPCR was normalized, and data were analyzed as described previously [18]. The primers used are as follows:S1pr1 forward, ATGGTGTCCACTAGCATCCCS1pr1 reverse, CGATGTTCAACTTGCCTGTGTAGβ-actin forward, CATCCGTAAAGACCTCTATGCCAACβ-actin reverse, ATGGAGCCACCGATCCACA