China 
Africa 
Explore chapters and articles related to this topic
Inflammatory Disorders of the Nervous System
Published in Philip B. Gorelick, Fernando D. Testai, Graeme J. Hankey, Joanna M. Wardlaw, Hankey's Clinical Neurology, 2020
Fingolimod was the first approved oral agent. It is a sphingosine-1-phosphate receptor blocker, and impedes the migration of CD4 T and B cells out of lymph nodes. It reduces RR by 50–55%, but it can cause cardiac rhythm problems, liver dysfunction, macular edema, pulmonary complications, and teratogenicity, together with PML in approximately 1/15,000 cases.
Neurological conditions
Published in David M. Luesley, Mark D. Kilby, Obstetrics & Gynaecology, 2016
Fingolimod is a sphingosine 1-phosphate receptor modulator, which sequesters lymphocytes in lymph nodes, preventing them from contributing to an autoimmune reaction. This drug should be discontinued at least 2 months before conception due to a presumed teratogenic risk shown in animals.
Pulmonary Endothelium in Health and Viral Infections
Published in Sunit K. Singh, Human Respiratory Viral Infections, 2014
Nikolaos Manitsopoulos, Frantzeska Frantzeskaki, Anastasia Kotanidou, Stylianos E. Orfanos
The cytoprotective effects of APC can be related to: (a) gene-expression alteration, (b) anti-inflammatory activities, (c) antiapoptotic activity, and (d) stabilization of the EC barrier. Most of these effects require the activation of protease-activated receptor-1 (PAR-1), while EPCR serves as a co-receptor. PAR-1 is a G-protein, which is activated via a proteolytic reaction. The anti-inflammatory properties of APC act through reduced expression of NF-κB, while cytokine signaling is inhibited by preventing the expression of cell surface adhesion molecules. Additionally, APC facilitates the production of prostacyclins via upregulation of inducible cyclo-oxygenase (COX) and appears to inhibit inducible NO synthase (iNOS) through decreased tumor necrosis factor (TNF)-α production.9–11 Furthermore, APC attenuates IL-1β- and thrombin-induced barrier disruption12 while in a more recent study induced barrier protection via cytoskeletal regulation mediated by sphingosine 1 phosphate receptor transactivation, combined with EPCR ligation.13 Regarding the above, a paradox arises referring to the beneficial effects of APC via PAR-1, while the same receptor is used by thrombin to exert its pro-inflammatory action. This leads to a hypothesis that PAR-1 can regulate either pro- or anti-inflammatory signals depending on the cell type and protease concentration.
Understanding and managing autonomic dysfunction in persons with multiple sclerosis
Published in Expert Review of Neurotherapeutics, 2021
Ivan Adamec, Magdalena Krbot Skorić, Mario Habek
Drugs that are used in treatment of MS may as well cause cardiovascular AD. Treatment of MS relapses with pulse corticosteroid therapy has been linked to occurrence of atrial fibrillation [35]. Some of the disease modifying therapies in MS, such as sphingosine 1-phosphate receptor modulators, are known to alter cardiovascular autonomic function. One example is fingolimod where treatment initiation must be accompanied with cardiac monitoring since sinus bradycardia may occur following its administration [36]. Hilz et al. demonstrated that fingolimod dampens autonomic modulation at the cardiac level which is the proposed mechanism for bradycardia development [37]. Similar effects on cardiovascular autonomic function have been noted with the use of siponimod, a more selective sphingosine 1-phosphate receptor modulator. After treatment initiation in a group of 26 pwMS a statistically significant decrease in heart rate and elevation of systolic blood pressure occurred where changes in heart rate variability were a predictor of heart rate decrease [38].
Mycobacterium bovis BCG-mediated suppression of Th17 response in mouse experimental autoimmune encephalomyelitis
Published in Immunopharmacology and Immunotoxicology, 2021
Goro Matsuzaki, Naoko Teruya, Hideyasu Kiyohara Kohama, Keiko Arai, Yukihiro Shibuya, Yasushi Chuma, Kazuhiro Matsuo
The expression of sphingosine-1-phosphate receptor 1 (S1PR1) was analyzed by qPCR. In brief, RNA was extracted using TRIzol reagent (Thermo Fisher Scientific), reverse-transcribed with a reverse transcriptase (SuperScript VILO cDNA Synthesis Kit; Thermo Fisher Scientific), and amplified with Taq polymerase premixed with SYBR Green using the Step One Realtime PCR System (Thermo Fisher Scientific). The qPCR was normalized, and data were analyzed as described previously [18]. The primers used are as follows:S1pr1 forward, ATGGTGTCCACTAGCATCCCS1pr1 reverse, CGATGTTCAACTTGCCTGTGTAGβ-actin forward, CATCCGTAAAGACCTCTATGCCAACβ-actin reverse, ATGGAGCCACCGATCCACA
Interactions between thymic endothelial cells and thymocytes are influenced by growth hormone
Published in Growth Factors, 2020
Marvin Paulo Lins, Iana Mayane Mendes Nicácio Viana, Salete Smaniotto, Maria Danielma dos Santos Reis
The vasculature plays a critical role in the thymic structure, influencing the entry and egress of lymphoid cells, as well as thymic tissue oxygenation and nutrition (Choi et al. 2013). Under physiological conditions, thymocytes do not self-renew; hence, it is necessary to continuously recruit lymphoid progenitor cells from the bone marrow via the bloodstream (Thapa and Farber 2019). T-cell progenitors enter the thymus via a stepwise cascade of rolling, activation, adhesion, and diapedesis. These events depend on the interaction of cell adhesion molecules expressed on thymic endothelial cells, such as selectins and integrins (Sitte et al. 2020). Once maturation is completed, thymocytes upregulate sphingosine‐1‐phosphate receptor 1, which binds to sphingosine-1-phosphate, and guides their emigration from the thymus. Mature thymocytes cross the basement membrane around the blood vessels at the corticomedullary junction, enter the perivascular space, and experience reverse transendothelial migration across the thymic endothelium, which enables them to join the peripheral T‐cell pool as recent thymic emigrants (James, Jenkinson, and Anderson 2018).