China
Africa
Explore chapters and articles related to this topic
Intraepithelial T cells: Specialized T cells at epithelial surfaces
Published in Phillip D. Smith, Richard S. Blumberg, Thomas T. MacDonald, Principles of Mucosal Immunology, 2020
Although genetic programming is involved in γδ gene rearrangements, selective TCRγδ-associated signals may also control the specific gut-homing ability of the TCRγδ+ precursors. For example, TCRγδ transgenic G8 thymocytes specific for the MHC class Ib molecules, T10b/T22b, differentiate in the presence of their cognate antigen, and directly home to the gut but nowhere else. Consistent with this, functional sphingolipid receptor, S1P1, is not required for egress of TCRγδ+ nIET precursor thymocytes. Thymic programming of TCRγδ progenitors is imprinted at the DN3 stage and requires a full γδ TCR together with CD3 components and functional linker for activation of T cells. Whether thymic ligand engagement is required for nIET precursors expressing an endogenous TCRγδ is still unclear, but it was shown for fetal TCRVγ5+ thymocytes that interaction with Skint1 on thymic epithelial cells induced a strong TCR signal that mediated induction of Tbx21 (or T-bet). The absence of ligand engagement resulted in the maintenance of Sox13 and induction of RORγt, mediating differentiation into distinct functional subsets.
Emerging drugs for the treatment of alopecia areata
Published in Expert Opinion on Emerging Drugs, 2022
Hassiel Aurelio Ramírez-Marín, Antonella Tosti
Sphingosine-1-phosphate (S1P) is a lipid metabolite that acts upon five different G-protein-coupled receptors (S1PR1-S1PR5), which are involved in lymphocyte/hematopoietic cell trafficking. An S1P gradient regulates lymphocyte migration to tissues [61]. S1RP1 modulators lead to degradation which causes lymphocytes to be incapable of following the S1P gradient to inflammation sites. S1P receptors antagonists are in development for multiple sclerosis, with five of them approved for its treatment (fingolimod, siponimod, ponesimod and ozanimod) [61]. Other immune diseases that could respond to these drugs include systemic lupus erythematosus, psoriasis, inflammatory bowel disease and rheumatoid arthritis. Possible side effects of S1PR modulators include leukopenia, anemia, transaminase elevation, macular edema, teratogenicity, pulmonary disorders, infections, and cardiovascular events [61].
Mycobacterium bovis BCG-mediated suppression of Th17 response in mouse experimental autoimmune encephalomyelitis
Published in Immunopharmacology and Immunotoxicology, 2021
Goro Matsuzaki, Naoko Teruya, Hideyasu Kiyohara Kohama, Keiko Arai, Yukihiro Shibuya, Yasushi Chuma, Kazuhiro Matsuo
The expression of sphingosine-1-phosphate receptor 1 (S1PR1) was analyzed by qPCR. In brief, RNA was extracted using TRIzol reagent (Thermo Fisher Scientific), reverse-transcribed with a reverse transcriptase (SuperScript VILO cDNA Synthesis Kit; Thermo Fisher Scientific), and amplified with Taq polymerase premixed with SYBR Green using the Step One Realtime PCR System (Thermo Fisher Scientific). The qPCR was normalized, and data were analyzed as described previously [18]. The primers used are as follows:S1pr1 forward, ATGGTGTCCACTAGCATCCCS1pr1 reverse, CGATGTTCAACTTGCCTGTGTAGβ-actin forward, CATCCGTAAAGACCTCTATGCCAACβ-actin reverse, ATGGAGCCACCGATCCACA
The safety and pharmacokinetics of a novel, selective S1P1R modulator in healthy participants
Published in Expert Opinion on Investigational Drugs, 2020
Shalabh Singhal, Ihab G. Girgis, Jenny Xie, Santanu Dutta, Diane E. Shevell, John Throup
Sphingosine-1-phosphate (2 S-amino-1-(dihydrogen phosphate)-4E-octadecene-1,3 R-diol; S1P) is a lysophospholipid ligand mediator that elicits a wide range of cellular responses through the stimulation of five G protein-coupled receptors (S1P1–5R) [1–4]. The S1P1 receptor (S1P1R) is distributed widely across multiple cell types including those of the immune, cardiovascular and central nervous systems. During the initial phase of the adaptive immune response, S1P1R signaling is required within developing T cells for their egress from the thymus and within peripheral lymphocytes for their migration from the spleen, lymph nodes and Peyer’s patches [5]. Downregulation of S1P1R expression on activated lymphocytes promotes their retention within peripheral antigen-bearing lymphoid organs [6,7]. In addition, S1P has the ability to downregulate inflammation via a number of processes including inhibition of tumor necrosis factor-alpha and interleukin-12 production by dendritic cells and inhibition of helper T-cell 1 responses [8]. As such, modulation of the S1P1R has been targeted as a way to suppress abnormal immune responses and modulate autoimmune inflammatory diseases [6,7].