Explore chapters and articles related to this topic
Transcriptional Regulation of the Human C3 Gene
Published in Andrzej Mackiewicz, Irving Kushner, Heinz Baumann, Acute Phase Proteins, 2020
Gretchen J. Darlington, Deborah R. Wilson, Todd S.-C. Juan
Site-directed mutants were produced by the procedure of Kunkel,37 with some modifications.18 Two constructs, C3R4Pst4 or C3R4Pst4MutERV, were used for generating single-stranded DNA templates. C3R4Pst4 was derived from pTZ19 (Pharmacia, Piscataway, NJ) and contained nearly 500 base pairs of the C3 promoter/enhancer region. C3R4Pst4mutERV is identical to C3R4Pst4 except that it contains a 6-bp mutation of CTGGGG found in the wild-type C3 promoter to an EcoRV site, GATATC. Single-stranded DNA templates were recovered from the supernatants of transformed Escherichia coli infected with the helper phage M13K07 (Pharmacia, Piscataway, NJ). Primer extension was then performed by hybridizing the single-stranded DNA templates with one of the single-stranded mutant oligonucleotides and elongating with T4 DNA polymerase as described.18 Mutant clones C3R4Pst4MutERV, C3R4Pst4MutSal, C3R4Pst4MutNru, C3R4Pst4MutNae, C3R4Pst4-MutBsA, and C3R4Pst4MutERV2 were done by using wild-type C3R4Pst4 as template; mutations were identified by restriction digestion using enzymes that recognized the mutant sequences we substituted. Mutants C3R4Pst4MutCT, C3R4Pst4MutGG1, and C3R4-Pst4MutGG2 were generated by using C3R4Pst4MutERV as template. Loss of the EcoRV site was used to identify clones containing substitutions within this region. All mutant constructs were inserted into the unique NcoI site of plasmid C31uc199ΔN/N (which has a deletion of 82 bp of the wild-type promoter) in order to create luciferase reporter constructs with mutant C3 promoters. Each one of these reporter constructs was further analyzed by diagnostic restriction digestion as well as by DNA sequencing to verify the presence of the mutation.
Kinetic Thinking: Back to the Future
Published in Clive R. Bagshaw, Biomolecular Kinetics, 2017
Sliding has also been examined by direct observation at the single-molecule level [713]. Typically, in these studies, the DNA is stretched out by flow before being tethered to a surface, and DNA binding proteins are imaged by means of a fluorescent tag. However, the length and time resolution of most experiments is limited to >30 nm and >10 ms, respectively, because of the limited photon emission rate. In this regard, quantum dots offer an advantage over organic fluorophores because of their resistance to photobleaching at high excitation intensity [714]. Low ionic strength is often used to prolong the attachment time and maximize the potential for diffusion. Early studies indicated sliding events extending from 120 nm to nearly 3 μm [715], with a wide range of apparent diffusion constants. However, the spatial resolution could not reliably distinguish 1D diffusion from hopping. Furthermore, 3D jumping is disfavored, as a consequence of extending the DNA, which potentially biases the contribution of 1D diffusion [97]. In studies on EcoRV restriction protein on noncognate DNA, apparent sliding was also observed, together with occasional large hops in both directions (up to 1.8 μm in 40 ms) [716]. The latter were identified as dissociation–reassociation events because their probability was reduced when the sample was subjected to transverse fluid flow, which would limit the chances of rebinding further along the DNA. Protein jumping between parallel DNA strands has also been observed at the single-molecule level [717]. In the case of RNA polymerases, early microscopy studies on the promoter search were interpreted as evidence of 1D sliding [718]. However, at high concentrations of RNA polymerase, thought to be physiologically relevant, direct collision of the promoter site by 3D diffusion predominated [719]. Indeed, in a direct comparison of RNA polymerase binding to DNA lacking or containing the promoter sequence, the 1D sliding was found to be too slow to be on the kinetic pathway for the promoter search [720]. In this assay, a brief encounter of RNA polymerase with nonspecific DNA would not be detected, but if the polymerase remained bound long enough to subsequently find the promoter by 1D diffusion, then the observed association rates to nonspecific and specific DNA should be similar.
Fast-tracking antibody maturation using a B cell-based display system
Published in mAbs, 2022
Hitomi Masuda, Atsushi Sawada, Shu-ichi Hashimoto, Kanako Tamai, Ke-Yi Lin, Naoto Harigai, Kohei Kurosawa, Kunihiro Ohta, Hidetaka Seo, Hiroshi Itou
Genomic DNA of VEGF_A033, D018, and D058 was extracted from the DT40 clones previously obtained from human ADLib®.22 The Ig genes of CDCP1_12A0416 were synthesized (by Azenta Life Sciences) based on the sequence determined from the mouse hybridoma cDNA. To introduce the exogenous HC V genes, the synthesized CDCP1_12A041 HC V gene and VEGF_A033, D018, and D058 HC V genes amplified using the primer F1(5’-CCCCACAGGGCTGATGGCGGAGGTG-3’) and R1 (5’- GAACGGTAGGGGATCCATAAAATCG −3’) were assembled with SV40 promoter-puromycin flanked by loxm7LE and loxm7RE and cloned into the EcoRV and BamHI sites of the HC V region knock-in vector. To introduce the exogenous LC V and constant region genes, the synthesized CDCP1_12A041 LC V gene and VEGF_A033, D018, and D058 LC V genes were amplified using the primer F1(5’- TTGCAGCATGAGCCCTTTGTTGTC −3’) and R1 (5’- TTCTATGAAGGGAGCCATAGCCTG −3’) and cloned into the BmgBI – NdeI site of the hCD4ΔC and kappa LC constant region targeting vector. Furthermore, the kappa LC constant region of VEGF_A033 LC V knock-in vector was replaced with human lambda LC constant region amplified from the human lambda LC V and constant region knock-in vector of human ADLib®.
A comprehensive insight into the potential roles of VDR gene polymorphism in obesity: a systematic review
Published in Archives of Physiology and Biochemistry, 2022
Amir Hossein Faghfouri, Elnaz Faghfuri, Vahid Maleki, Laleh Payahoo, Adam Balmoral, Yaser Khaje Bishak
So far, eight studies have investigated the relationship between ApaI polymorphism and obesity phenotypes in cross-sectional studies. ApaI polymorphism was not associated with obesity risk in central European Caucasian individuals of Czech origin. Nonetheless, the “Aa” genotype corresponded to decreased WC as compared to the “AA” genotype (β = −4.37, 95% CI: −7.54; −1.20, p = .007). Gene-gene interactions analysis of ApaI, EcoRV and FokI in multivariable models adjusted for gender, age, BMI, total energy intake, smoking, type of work, shift work and comorbidities revealed that the “Aa” genotype was related to reduced WC as compared to the “AA” genotype (β = −1.68, 95% CI: −2.88; −0.48, p = .006) (Bienertová-Vašku et al.2017). Also, each additional of ApaI “a” allele in additive model in Shen et al. (2019) study was associated with increased BFP and triceps skinfold thickness (β ± SE= 0.087 ± 0.039, p = .02 and β ± SE= 0.122 ± 0.034, p < .001, respectively). Also, the combination of ApaI, FokI and rs2239179 resulted in a higher BFP and triceps skinfold thickness after adjustments for age, gender, alcohol, high-fat diet and the family history of obesity (p < .05). In a dominant model, a positive association between ApaI polymorphism and BMI scores was found following adjustments for age and gender (p < .05) (Al-Daghri et al.2014). Also, in healthy young populations, the “AA” male carriers had a higher BMI and WC compared to those with other genotypes (Hajj et al.2016).
A feature-based analysis identifies COL1A2 as a regulator in pancreatic cancer
Published in Journal of Enzyme Inhibition and Medicinal Chemistry, 2019
Jie Wu, Jing Liu, XiaoQing Wei, Qi Yu, XiangHuan Niu, ShuHong Tang, Lei Song
Using siRNA to interfere with COL1A2 gene transcription, the siRNA for specifically knocking down COL1A2 was transferred into shRNA which was inserted into pSilencer2.1-U6 neo vectors (Ambion, Austin, TX) at the BamHI and HindIII cleavage sites. The pcDNA 3.1-neo vector (Thermo Fisher Scientific, Waltham, MA) were used to constructed COL1A2 overexpression vector with sites of HindIII and EcoRV. MiR-25–3p (5′-CAU UGC ACU UGU CUC GGU CUG A-3′) mimics and inhibitor were commercially synthesised by Thermo Fisher Scientific. Lipofectamine 2000 reagent (Invitrogen Inc, Carlsbad, CA) was adopted for plasmid transfection in accordance with the manufacturer’s instructions.