China
Africa
Explore chapters and articles related to this topic
Exercise Training, Mitochondrial Adaptations, and Aging
Published in Peter M. Tiidus, Rebecca E. K. MacPherson, Paul J. LeBlanc, Andrea R. Josse, The Routledge Handbook on Biochemistry of Exercise, 2020
Nashwa Cheema, Matthew Triolo, David A. Hood
Within the nuclear genome, p53 supports mitochondrial biogenesis by up-regulating the expression of genes indicative of oxidative phenotypes such as PGC-1 α (15, 78), Tfam (15, 124, 143), and NRF-1 (143), as well as the ETC assembly protein synthesis of cytochrome C oxidase 2 (SOC2) (107). Within the mitochondrial genome, p53 induces the transcription of 16S rRNA (45) and cytochrome C oxidase subunit I (145), likely through interactions with Tfam (189). In addition to this transcriptional role, mitochondrial p53 interacts and stabilizes mtDNA (123). In fact, knockout of p53 in mice reduces basal mitochondrial content and leads to disrupted mitochondrial morphology with diminished function (15, 142, 146).
Identification of Medically Important Arthropods
Published in Gail Miriam Moraru, Jerome Goddard, The Goddard Guide to Arthropods of Medical Importance, Seventh Edition, 2019
Gail Miriam Moraru, Jerome Goddard
In the last decade, there has been an effort to barcode the world’s animal life using the cytochrome c oxidase subunit I gene (COXI). Use of DNA barcodes has supposedly been validated,1 although not all scientists agree.2 According to Will,2 people seeking a panacea of molecular identification of species will encounter all sorts of constraints and inconsistencies in their work: most importantly, judgments about species boundaries. This problem is addressed in a paper by Sperling,3 wherein he discusses what DNA sequence or allozyme divergence number is the cutoff above which populations can be considered separate species. Based on data from Paplio butterflies, Sperling says it is unreasonable to expect any kind of simple relationship between percent sequence divergence and maintenance of genetic integrity.3
Mitochondrial DNA Mutations and Neurodegenerative Diseases
Published in Sara C. Zapico, Mechanisms Linking Aging, Diseases and Biological Age Estimation, 2017
Electron microscopy examinations of muscle, liver, spinal motor neurons and motor cortex revealed structural defects in the mitochondrial DNA (Menzies et al. 2002). A mutation in cytochrome c oxidase subunit I was found in a patient with a motor neuron disease phenotype (Comi et al. 1998). Another patient with motor neuron disease had a mutation in a mitochondrial tRNA gene. Other study examined the role of somatic mtDNA mutations in human aging by quantifying the accumulation of the common 4,977 nucleotide pair (np) deletion (mtDNA4977) in the cortex, putamen and cerebellum. They found a significant increase in the mtDNA4977 deletion in elderly individuals. Similar changes were observed with a different 7436 np deletion. These changes suggest that somatic mtDNA deletions might contribute to the neurological impairment often associated with aging (Corral-Debrinski et al. 1992). However, no significant accumulation of the 5 kb (4977) common deletion in mtDNA has been found by single-cell analysis of motor neurons from sporadic ALS cases (Mawrin et al. 2004).
Activation of AMPK-PGC-1α pathway ameliorates peritoneal dialysis related peritoneal fibrosis in mice by enhancing mitochondrial biogenesis
Published in Renal Failure, 2022
Jun Wu, Jushuang Li, Baohong Feng, Zhimin Bi, Geli Zhu, Yanxia Zhang, Xiangyou Li
The visceral peritoneal membrane (mesentery tissue 50 mg) was collected. Total DNA was isolated from peritoneal tissue using the DNeasy Blood & Tissue kit (Qiagen) according to the manufacturer’s instructions. Total RNA was extracted from peritoneal tissue with TRIzol reagent according to the manufacturer’s instructions. Real-time polymerase chain reaction (RT–PCR) was performed using the ABI 7900HT sequence detection system (Applied Biosystems). The following primers were used. GGCCTGACTGGCATTGTATT (forward) and TGGCGTAGGTTTGGTCTAGG (reverse) for mitochondrial DNA-encoded cytochrome c oxidase subunit I (COX I), GCCGACTAAATCAAGCAACA (forward) and CAATGGGCATAAAGCTATGG (reverse) for COX II, TAGAGGGACAAGTGGCGTTC (forward) and CGCTGAGCCAGTCAGTGT (reverse) for nucleus-encoded 18S ribosomal DNA(18S rDNA). CAATTGAAGAGCGCCGTGT (forward) and CCATCATCCCGCAGATTTAC (reverse) for PGC-1α and GGGAAACTGTGGCGTGAT (forward) and GAGTGGGTGTCGCTGTTGA (reverse) for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Data were analyzed using the 2−ΔΔCt method. The relative mitochondrial copy number was evaluated by calculating the ratio of COX I or COX II to 18S rDNA.
Use of Molecular Methods to Authenticate Animal Species and Tissue in Bovine Liver Dietary Supplements
Published in Journal of Dietary Supplements, 2022
Olive J. Dahm, Georgia L. Sampson, Anthony J. Silva, Rosalee S. Hellberg
Current molecular laboratory methods for detecting animal or plant ingredients in dietary supplements include real-time PCR and DNA barcoding. Real-time PCR is a targeted approach that uses species-specific primers to identify species in real-time (Köppel et al. 2011, 2013). The combination of species-specific primers in a multiplex, real-time PCR assay allows for multiple species to be detected simultaneously. For example, Köppel et al. (2011) developed a multiplex real-time PCR assay with the commercial name AllHorseTM that simultaneously detects domestic cattle (Bos taurus) and several common substitute species, including pig (Sus scrofa), horse (Equus caballus), and sheep (Ovis aries). On the other hand, DNA barcoding uses universal primers that amplify a short, standardized region of DNA (Hebert et al. 2003). For DNA barcoding of animal tissues, the most common target is a ∼655 base pair (bp) region of the mitochondrial gene coding for cytochrome c oxidase subunit I (COI). Because DNA degradation can occur during processing, test methods for animal species in processed products often target mini-barcodes, which are shorter regions (< 300 bp) of the DNA barcode (Hellberg et al. 2019; Wu et al. 2019; Zahn et al. 2020). For example, one study reported increased success when using DNA mini-barcoding compared to full-length DNA barcoding for the detection of species in shark cartilage dietary supplements (Hellberg et al. 2019). A novel DNA mini-barcode assay was developed specifically for the identification of animal species in processed foods; however, it has not yet been tested with dietary supplements (Wu et al. 2019).