China
Africa
Explore chapters and articles related to this topic
The Immune System and Immune Modulation
Published in Thomas F. Kresina, Immune Modulating Agents, 2020
François Hirsch, Guido Kroemer
Lymphocytes expressing clonally distributed antigen receptors at the cell surface constitute the principal elements of the immune system. Cognate activation of these clonally distributed polymorphic receptors with their physiological ligands (peptide/major histocompatibility complex [MHC] complexes in the case of the T cell receptor, antigen in the case of suface immunoglobulin) is specific in the sense that it only concerns a minor fraction of the overall immune repertoire. In addition, lymphocytes receive signals via monomorphic receptors (coreceptors, cytokine receptors). Such noncognate signals are nonspecific inasmuch as they can be received by the majority or a large fraction of lymphocytes. In this sense, immunomodulatory interventions on monomorphic receptors are always nonspecific (Table 1). Molecules that are designed to interact with antigen receptors also can vary in their specificity. Thus, for instance, antibodies that recognize common features of the T lymphocytes bearing αβ-type antigen receptor/cluster designation (TCRα/β/CD3) complex will have nonspecific effects, whereas antigenic peptides will have strictly specific effects. On an intermediate stage, reagents that recognize a substantial portion of the immune repertoire (e.g., superantigens or antibodies recognizing products from V genes of the TCR or immunoglobulin [Ig] loci) can be viewed as semispecific modulators (Table 1).
Delivery of Immune Checkpoint Inhibitors Using Nanoparticles
Published in Hala Gali-Muhtasib, Racha Chouaib, Nanoparticle Drug Delivery Systems for Cancer Treatment, 2020
Abdullah Shaito, Houssein Hajj Hassan
A single signal is not enough for T cell activation; a T cell is not activated when the TCR (T cell receptor) binds an antigen-bound MHCI complex. T cell activation requires an additional signal viz. the binding of co-receptors. This second signal has been termed co-stimulation. In T cells, the second signal takes place when CD28 present on T cells binds to CD86 (B7-2) or CD80 (B7-1) expressed by APCs [16–18]. These co-receptors or co-stimulants, when active, act as accelerators that promote the T cell activation and, hence, the immune response. However, it was later discovered that some co-receptors act, in fact, as brakes that reduce the activation of T cells. These brake co-receptors are required, as mentioned above, to avoid an exaggerated and damaging immune response. The brakes inhibitory signaling pathways, are termed the immune checkpoints, and constitute any signal that inhibit priming of T cell activation or any signal that reduce an already initiated T cell response [19].
Monocyte and lymphocyte membrane markers: Ontogeny and clinical significance
Published in Gabriel Virella, Medical Immunology, 2019
Scott Sugden, Damien Montamat-Sicotte, Karen K. Yam, Joseph Murphy, Bader Yassine Diab, Virginia Litwin
TCR and BCR are similar in structure, composed of highly diverse, antigen-specific variable regions and conserved constant regions (Figures 10.5 and 10.6). Their short intracytoplasmic regions are not capable signal transduction but are associated with co-receptor molecules that lend signal transduction capacity to the mature receptor complex.
Generalized pustular psoriasis: the new era of treatment with IL-36 receptor inhibitors
Published in Journal of Dermatological Treatment, 2022
Cláudia Oliveira Maçães, Ana Maria Lé, Tiago Torres
Nevertheless, in recent years, another family of cytokines has been calling for attention when it comes to GPP. The primary role belongs to the IL-1 gene superfamily, located in a cluster on chromosome 2, of which are part the following IL-36 subfamily of cytokines: IL-36α, IL-36β, IL-36γ, known to be pro-inflammatory agonists, and IL-36Ra and IL-38, the antagonists (10,34). N-terminal proteolytic cleavage and enzymatic activity are crucial for the activation and full optimal function of IL-1 family cytokines (35). They regulate the innate immune system and, with the binding of the agonists to its respective receptor, IL-36R, heterodimerisation of its IL-1RL2 subunit with co-receptor IL-1RAPcP is promoted. The IL-36R:IL-1RAcP complex induces TIR activation and the intracellular signaling pathway – MyD88/IRAK/TRAF/MAPK – is initiated. This activation results in the activation of transcription factors AP-1 and NF-κB in the nucleus, which will promote the transcription of pro-inflammatory genes and its expression. An inflammatory response takes course, with the release of chemokines and cytokines such as IL-1, IL-6 and IL-8, that will stimulate immunologic system cells’ activation. The IL-36Ra and IL-38 are responsible for the control of this inflammatory reaction, binding to the same receptor protein with higher affinity, suppressing IL-1RAcP recruitment and blocking the connection to IL-36α, IL-36β and IL-36γ, inhibiting the IL-36R signaling (Figure 1) (10,36,37). IL-36α isoform seems to be the primary IL-36 agonist implicated in skin pathology (12).
Neurodevelopmental and transcriptomic effects of CRISPR/Cas9-induced somatic orco mutation in honey bees
Published in Journal of Neurogenetics, 2021
Zhenqing Chen, Ian M. Traniello, Seema Rana, Amy C. Cash-Ahmed, Alison L. Sankey, Che Yang, Gene E. Robinson
A single guide RNA (sgRNA) targeting orco was designed using the CRISPR Guide RNA Design tool in Benchling (http://benchling.com): from the recommended candidates, we selected a target site in the 2nd exon in the gene with excellent on-target score and minimal off-targets near genes in the genome. In the Orco protein this site is in the second of seven transmembrane domains. A frameshift mutation here would disrupt all the important downstream domains. Indels of amino acid residues here would likely affect the conformation of this domain and thus the function of the co-receptor. We used a MiniGene plasmid with the following DNA template containing a T7 promoter and site-specific targeting sequence (in bold and underlined, respectively): TAATACGACTCACTATAGGCTGTGCGTGAGAAGAGCAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTAAAAGAGACC (Integrated DNA Technologies, Coralville, IA). The plasmid was linearized by BsaI digestion. sgRNA was transcribed in vitro with the T7 RiboMAX™ Express Large Scale RNA Production System (#P1320, Promega, Madison, WI) and purified with Monarch RNA Cleanup Kit following standard protocol in the manual (New England Biolabs, Ipswich, MA).
Can gut microbiota of men who have sex with men influence HIV transmission?
Published in Gut Microbes, 2020
Sara L. Coleman, C. Preston Neff, Sam X. Li, Abigail J.S. Armstrong, Jennifer M. Schneider, Sharon Sen, Blair Fennimore, Thomas B. Campbell, Catherine A. Lozupone, Brent E. Palmer
As mentioned, HIV infection requires co-receptors CCR5 or CXCR4 to be present on a cell; both of which are G-protein-coupled receptors. CCR5 interacts with cytokine family members CCL3/4/5 and CCR5 chemokine agonists have been an area of investigation for influencing the level of available CCR5 and thus reducing HIV utilization of the receptor for infection. Downregulation of peripheral blood chemokine agonist CCL3/4/5 gene expression was shown following acute infection with CCR5-tropic SHIV infection in rhesus macaques.57 For our MSM cohort, we demonstrated that CCR5 frequencies are increased in the rectosigmoid colon. Measurement of CCR5 agonists in the colon would be beneficial for determining the relative availability of the CCR5 receptor. It is not clear exactly how the microbiome influences integrin and chemokine receptor expression; however, with MSM-associated microbes influencing CCR5 expression (a G-protein-coupled receptor) it is interesting that the abundance of H. biformis (an MSM-associated bacteria) also associated with another G-protein-coupled receptor in HIV+ African children.58 Direct investigation of the effects of C. mitsuokai and H. biformis on T-cell activation and homing, as well as expression of CD103 (integrin αE) and CCR5 would help to fully explain MSM microbiome-associated inflammation and the risk of HIV transmission.