China
Africa
Explore chapters and articles related to this topic
Aetiology and Laboratory Diagnosis
Published in Raimo E Suhonen, Rodney P R Dawber, David H Ellis, Fungal Infections of the Skin, Hair and Nails, 2020
Raimo E Suhonen, Rodney P R Dawber, David H Ellis
This is the most widely used technique but it may take time for the specimen to clear and stain. However, preparations last a long time and may be kept until the culture result is known. Dissolve the 10gm of potassium hydroxide (KOH) in 80 ml of distilled water, men add 10 ml of glycerol and 10 ml of Parker Quink permanent blue ink. The glycerol prevents crystallisation of the reagent and prevents the specimen from drying out. Mount a small portion of the specimen in a drop of stain, cover with a coverslip, squash the preparation with the butt of the inoculation needle and then blot off the excess fluid. Gendy heat by passing through a flame two or three times. Do not boil. When the specimen has cleared, which may take up to 20 minutes for skin scrapings to several hours for nail scrapings, examine microscopically for the presence of faintly blue-stained fungal elements.
Lacticaseibacillus paracasei sh2020 induced antitumor immunity and synergized with anti-programmed cell death 1 to reduce tumor burden in mice
Published in Gut Microbes, 2022
Shi-Long Zhang, Bing Han, Yu-Qin Mao, Zheng-Yan Zhang, Zhan-Ming Li, Chao-Yue Kong, You Wu, Guo-Qiang Chen, Li-Shun Wang
Fecal sample was homogenized in sterile physiological saline in a 15 ml sterile centrifuge tube. After centrifugation (1000 g, 1 min), the supernatant was incubated in a modified MRS medium for 18–24 h. After which, 10 µL of the enrichment cultures were streaked on the Rogosa agar, a highly selective media for the isolation of Lactobacillus spp,45 and incubated at 37°C for 24–48 h under aerobic conditions. After incubation, a sterile inoculation needle was used to pick up single colonies and streak them on clean plates to obtain pure cultures. Genome DNA was isolated for 16s rRNA PCR to verify the purified strain type. As for whole-genome sequencing, the bacterial genomic DNA was extracted for Oxford Nanopore and Illumina sequencing. Sequence blasts were carried out in the National Center for Biotechnology Information (NCBI) database. The high-quality reads were assembled by Miniasm.24 The genomes data for other Lactobacillus strains available in the NCBI database were downloaded for the comparative analysis.
Hemolysin BL from novel Bacillus toyonensis BV-17 induces antitumor activity both in vitro and in vivo
Published in Gut Microbes, 2020
Jiajia Chen, Shoukui Hu, Dengbo Ji, Zhaoya Gao, Hanyang Wang, Yong Yang, Yongkang Chen, Jin Gu
Feces (0.5 g) from the healthy donors were homogenized in 5 ml of sterile PBS in a 15 ml sterile centrifuge tube. Centrifugation was carried out at 1000 RPM for 1 min and then a 50 µl aliquot of the supernatant was directly spread onto blood agar plates. The plates were incubated at 37°C for up to 3 days under both anaerobic and aerobic conditions. After which, a sterile inoculation needle was used to pick up single colonies and streak them on clean plates in order to culture pure colonies. Pure colonies of interest were examined by Gram-stain under a light microscope and by PCR for colony identification. Briefly, pure colonies were inoculated into a 100 µl Eppendorf tube containing 50 µl sterile water, this bacterial suspension was then boiled for 20 min at 99°C and cooled to 4°C. The resulting DNA (2 µl) was used in a 50 µl PCR reaction with universal bacterial primers, 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (TACGGCTACCTTGTTACGACTT) to amplify the bacterial 16S rRNA gene. The PCR products were sequenced by TIANYI HUIYUAN Company and blasted on the NCBI database to preliminarily identify the isolated bacteria. As for whole-genome sequencing, the bacterial genomic DNA was extracted using a TIANamp Bacteria DNA Kit (DP302), according to the manufacturer’s instructions, and then sequenced with Illumina PE150 by Novogene Company.