China
Africa
Explore chapters and articles related to this topic
A Survey of Newer Gene Probing Techniques
Published in Victor A. Bernstam, Pocket Guide to GENE LEVEL DIAGNOSTICS in Clinical Practice, 2019
A further refinement of the analysis of minisatellites can be achieved by mapping variant repeat units within amplified alleles. This approach dramatically enhances the number of different alleles that can be distinguished in a population. For example, in the human hypervariable locus D1S8 this PCR-based technique can distinguish over 1070 allelic states. Two rounds of PCR amplification of genomic DNA are performed: first, two parental alleles are isolated by PCR, and then much shorter mutant alleles produced by internal deletions within a variable repeat unit are amplified. A combination of two restriction digest patterns is used. Partial digestion with HinfI, followed by electrophoretic separation of the fragments, allows the determination of the number of minisatellite repeat units. Comparison of the partial digest patterns produced by HaeIII and HinfI enables each repeat unit to be evaluated for the presence of a mutation reflected in the presence of a restriction site for HaeIII.
Microarrays: Human Disease Detection and Monitoring
Published in Attila Lorincz, Nucleic Acid Testing for Human Disease, 2016
Janet A. Warrington, Thomas B. Broudy
Computer modeling of the restriction digest tells researchers which SNPs are present on which DNA fragments, allowing them to then select probes against the SNP sequences that will be applied to the array. For the mapping 100K set, two separate restriction enzymes are used and each enzyme creates a pool of DNA fragments containing over 50,000 SNPs to be genotyped.
Gene Structure and Expression in Colon Cancer
Published in Leonard H. Augenlicht, Cell and Molecular Biology of Colon Cancer, 2019
SW480 was the first colon carcinoma cell line shown to contain an activated transforming gene, as assayed by transfection into 3T3 cells with concomitant morphological transformation.10 Similar results were soon reported for SK-CO-1 colon carcinoma cells, though HT29 were negative.12 Two immediate questions that arose were whether such transforming genes were present in primary colon tumors, rather than cell lines, and the frequency of their occurence. Of 28 primary tumors tested, 5 were positive by transfection assay, including 2/2 colon carinomas.27 However, following the identification of the T24 (or EJ) bladder tumor cell-transforming gene as the c-Ha-ras 1 gene containing a mutation in amino acid position number 12 (GGC → GTC; glycine → valine),16-18 Feinberg et al.28 reported mutations at this site to be very rare in human tumors and, in fact, absent in nine primary colon carcinomas as well as ten lung carcinomas and ten bladder carcinomas. This negative conclusion has been found to rest on two technical difficulties in the experiment. First, the restriction digest assay utilized detects only the c-Ha-ras 1 gene and the transforming gene in SW480 cells,29 as well as most colon tumors which are positive 30,31 is the c-Ki-ras 2 gene containing a mutation at amino acid position number 12 or 61. In SW480 cells, this is a GGT → GTT transition (gly → val) at position 12.32 Second, this c-Ki-ras 2 gene is about 38 Kb in length 21 and will often not be intact in isolated DNA even if of relatively high molecular weight. Hence, even if “activated” by mutation in a tumor, it is often unable to act as a transfectable transforming gene.
Genome-edited zebrafish model of ABCC8 loss-of-function disease
Published in Islets, 2022
Jennifer M. Ikle, Robert C. Tryon, Soma S. Singareddy, Nathaniel W. York, Maria S. Remedi, Colin G. Nichols
ENU-mutagenesis was performed at the Sanger Institute, as part of the Zebrafish Mutation Project, using N-ethyl-N-nitrosourea (ENU) mutagenesis to attempt to identify knockout alleles for all protein-coding regions in the zebrafish genome (https://www.sanger.ac.uk/resources/zebrafish/zmp/). This project outcrosses ENU-mutagenized F0 males to create a population of F1 fish heterozygous for ENU-induced mutations, which were then obtained through the Zebrafish International Research Consortium (ZIRC). The abcc8(sa15863) nonsense mutant allele (K499-STOP, TTCTGGCTCCRGTGCAGTACTTTGTGGCAACCAAGTTATCAGATGCACAG[A > T]AAAGCACATTGGTGAGCTACTTTATTTTGGTTAATGTCCTAATGAGGCCA) was obtained from the Zebrafish Mutation Project,24 through ZIRC. Homozygous K499-STOP mutants were generated by in-crossing heterozygous carriers, and the progeny was genotyped by Transnetyx using restriction digest with the inserted digestion site for HpyCHRIII, which is inserted into the mutant allele (Forward primer: TTGTTGTTGTCTGCTTTTTGC; Reverse primer: TTTACAAGCACAGCGCTCAC) to identify homozygotes.
The Drosophila foraging gene plays a vital role at the start of metamorphosis for subsequent adult emergence
Published in Journal of Neurogenetics, 2021
Ina Anreiter, Aaron M. Allen, Oscar E. Vasquez, Lydia To, Scott J. Douglas, Javier V. Alvarez, John Ewer, Marla B. Sokolowski
The galK selection/counter-selection (as in Warming, Costantino, Court, Jenkins, & Copeland, 2005) was used to introduce a premature stop codon and transcription terminator into a bacterial artificial chromosome (BAC) containing the 35 kb for locus. Generation of this 35 kb construct was previously described (Allen et al., 2017). The GalK sequence was PCR amplified with comStop-galK-F and comStop-galK-R primers (Table S1) and integrated into the BAC at the start of the first coding exon common to all transcripts. An hsp70 transcription terminator was amplified with primers comStop-F and comStop-R (Table S1). A single SNP was included in the for specific region of the comStop-F to introduce a premature stop codon once integrated into the locus (Y573X, relative to for-PA). This PCR product was then used to replace the GalK sequence in the for BAC, introducing a premature stop codon and transcription terminator. The BAC was verified by PCR, restriction digest, and Sanger sequencing. The BAC was incorporated into the fly’s genome using φC31 integration into the attP2 landing site on the third chromosome (Groth, Fish, Nusse, & Calos, 2004). Transgenesis was performed by Genetic Services Inc.
Spatial analysis of gut microbiome reveals a distinct ecological niche associated with the mucus layer
Published in Gut Microbes, 2021
Kellyanne Duncan, Kelly Carey-Ewend, Shipra Vaishnava
PCR amplified 16S rRNA gene from mouse fecal sample using Taq polymerase as described in the TOPO TA Cloning Kit User Guide with 16S rRNA Universal primers recognizing 340 F and 514 R.80 Cloned PCR product into a pCR 2.1-TOPO vector using the TOPO TA Cloning Kit and transformed recombinant vector into One Shot TOP10 Chemically Competent E.coli as described in the TOPO TA Cloning Kit User Guide. Isolated plasmid DNA with the Invitrogen PureLink Quick Plasmid Miniprep Kit. Checked 16S rRNA gene properly inserted into vector with PCR and EcoR1 restriction digest following protocol provided with restriction enzyme. Generated a standard curve using quantitative PCR and primers 340 F and 515 R with plasmid DNA of known concentrations, relating DNA concentration to copy number using the equation provided in Park and Crowley, 2005. Found the best fit line between CT value vs. copy number in order to relate the CT value of the unknown sample values to copy number.