China
Africa
Explore chapters and articles related to this topic
Aicardi Syndrome and Klinefelter Syndrome
Published in Dongyou Liu, Handbook of Tumor Syndromes, 2020
The impact of supernumerary X-chromosome(s) on Klinefelter syndrome phenotypic features and variability involves several mechanisms, including (i) gene dosage compensation, (ii) skewed X-inactivation, (iii) genetic polymorphisms, and (iv) parental origin of supernumerary X chromosome.
Microdeletion Syndromes
Published in Merlin G. Butler, F. John Meaney, Genetics of Developmental Disabilities, 2019
Gopalrao V. N. Velagaleti, Nancy J. Carpenter
Chromosome rearrangements that result in interstitial or terminal deletions or unbalanced translocations lead to disturbances in gene dosage. The rearrangements may be relatively large, one to several million bases in length, and involve a large number of genes. Disorders in which loss of multiple genes at closely linked loci result in diverse phenotypic effects are known as microdeletion or contiguous gene syndromes.
Cell Mediated Lympholysis: A One Step Microplate Technique
Published in Soldano Ferrone, B. G. Solheim, HLA Typing: Methodology and Clinical Aspects, 2019
Miggianno et al. reported in 1972 on a family study where cytotoxic cells were initiated with stimulator cells, sharing one or no haplotypes with the responder, and tested on target cells sharing one or two haplotypes with the stimulator.17 The degree of killing was found to be dependent on the number of mismatched antigens between responder and stimulator, and on the degree of antigens shared between stimulator and target cells (gene dosage effect). Performing similar experiments between serologically HLA typed nonrelated persons gave a similar gene dosage dependent killing.18, 19
Dietary Pattern, Genomic Stability and Relative Cancer Risk in Asian Food Landscape
Published in Nutrition and Cancer, 2022
Razinah Sharif, Suzana Shahar, Nor Fadilah Rajab, Michael Fenech
Telomeres consist of a conserved hexanucleotide repeat sequence (TTAGGG) that caps the ends of chromosomes and protects them from recombining with each other and thus preventing chromosomal end-to-end fusions. Degradation of telomeres has been shown to lead to chromosomal instability, via telomere end fusions resulting in generation of abnormal dicentric chromosomes and breakage-fusion-bridge cycles within these abnormal chromosomes (75, 76). This leads to gene amplification and gene dosage imbalance which is an important risk factor for cancer. Accelerated telomere shortening and telomere end fusions can result in a persistent DNA damage response leading to cell cycle arrest and apoptosis. Although telomere shortening has been proposed as one of the fundamental mechanisms that determine chromosomal instability, and increased cancer risk, studies on the relationship between dietary factors and telomere biology have mainly focused on western diets such as the Mediterranean diet which is protective but knowledge remains limited with respect to Asian dietary patterns (77, 78).
Germline IKZF1 mutations and their impact on immunity: IKAROS-associated diseases and pathophysiology
Published in Expert Review of Clinical Immunology, 2021
Hye Sun Kuehn, Cristiane J Nunes-Santos, Sergio D. Rosenzweig
Therapeutically speaking, IKAROS-associated diseases could be cured by HSCT as has already been shown in patients with somatic defects, as well as in those carrying HI and DN germline allelic variants. On the other hand, most of these patients and their complications are symptomatically treated, either prophylactically or therapeutically. When focused on gene-specific medical treatments oriented to restore a function that is lost (as in IKAROS HI, DN, and DD patients), this aim proved to be more difficult than trying to ameliorate an excessive function, as shown in patients with gain-of-function defects in STAT1 and the use of Janus kinase (JAK)-inhibitors controlling the signaling in this pathway [57]. By the same token, if IKAROS gain-of-function defects are eventually detected, FDA-approved and commercially available thalidomide analogs known to promote IKAROS degradation via increased ubiquitination and degradation [58] may become useful as part of the medical armamentarium for such allelic variants and disease. While gene-therapy for IKZF1 defects and other germline dominant monogenic diseases seems like a plausible goal to achieve in the future, the very precise and fine-tuned gene dosage regulation of IKZF1/IKAROS is subjected to, adds another layer of complexity to this already ambitious task.
Copy-number variations in adult patients with chronic immune thrombocytopenia
Published in Expert Review of Hematology, 2020
Emrah Yucesan, Ozden Hatirnaz Ng, Fevzi Firat Yalniz, Hulya Yilmaz, Ayse Salihoglu, Tugce Sudutan, Ahmet Emre Eskazan, Seniz Ongoren, Zafer Baslar, Teoman Soysal, Ugur Ozbek, Muge Sayitoglu, M. Cem Ar
Increased and decreased CNVs were validated by gene dosage analysis. Quantitative real-time PCR (qRT-PCR) was carried out on the Light Cycler 480 Instrument (Roche Applied Sciences, Mannheim, Germany). Gene dosage analysis was performed with LC480 SYBR Green I Master (Roche) as described in the protocol. For normalization MRPL28 gene was used as a housekeeping gene. To validate the findings two representative regions, one copy and three copies of CNV regions (19q and 2p, respectively) were selected. In 19q region CYP2B6 locus (forward 5ʹGCCATACACAGAGGCAGTCA and reverse 5ʹTCGGGGATTAAGAGAATCCA) and in 2p region LCLAT1 locus (forward 5ʹTTCCTGTGGAATTGCCTGAT and reverse 5ʹAAATGGAATCGCTTTAATGCTT) was validated. A total of 50 ng of genomic DNA was used in each PCR reaction, which was conducted in triplicates. PCR conditions were as follows: 5 minutes at 95°C followed by 35 cycles of 30 seconds of denaturation at 95°C and 30 seconds of annealing 60°C and 30 seconds of extension at 72°C. Melting curve analysis was performed to check the product specificity. Delta Ct method is used to calculate the relative gene dosage.