China
Africa
Explore chapters and articles related to this topic
A diabetic with diarrhoea
Published in Tim French, Terry Wardle, The Problem-Based Learning Workbook, 2022
A systematic approach to understanding anaemia is important. A raised MCV is usually due to Vitamin B12 or folate deficiency, chronic alcohol consumption or hypothyroidism. Microcytosis is usually due to iron deficiency or blood loss. In this scenario, the presence of both macrocytes and microcytes should alert to the possibility of B12 and/or folate deficiency, and iron deficiency (see p. 228).
Hematopoietic System
Published in Pritam S. Sahota, James A. Popp, Jerry F. Hardisty, Chirukandath Gopinath, Page R. Bouchard, Toxicologic Pathology, 2018
Kristin Henson, Tanasa Osborne, Gregory S. Travlos
Dysplastic changes in erythroid, myeloid, or megakaryocytic lineages are the result of maturation defects resulting in abnormal nuclear and/or cytoplasmic morphology. If significant, the alteration in maturation may be associated with ineffective hematopoiesis with concomitant peripheral cytopenias in affected cell line(s). Red blood cell indices may be indicative of erythrocyte macrocytosis or microcytosis. Marrow cellularity may be decreased, normal, or increased depending on the causative agent or inciting event, with increased numbers of precursors related to ineffective hematopoiesis often observed. Hematopoietic cell dysplasia is best identified on cytologic preparations, although changes in megakaryocytes can be seen in histologic sections. Dysplasia, while a characteristic feature of myelodysplastic syndrome (MDS) and other myeloproliferative disorders, has also been associated with drug or chemical exposure, nutritional deficiencies, chronic blood loss, and recovery from previous hypoplasia with increased cell production.
M
Published in Anton Sebastian, A Dictionary of the History of Medicine, 2018
Microcytosis [Greek: mikros, small + kytos, cell] Characterized by the presence of small hemoglobin-containing erythrocytes or microcytes in the blood. Observed by Constant Vanlair (1839–1914) and Jean Baptiste Nicolas Voltaire Masius (1836–1912) of Belgium around 1890. See iron deficiency anemia.
Hemoglobinopathy gone astray—three novel forms of α-thalassemia in Norwegian patients characterized by quantitative real-time PCR and DNA sequencing
Published in Scandinavian Journal of Clinical and Laboratory Investigation, 2021
Runa M. Grimholt, Bente Fjeld, Olav Klingenberg
Samples from patients suspected of having α-thalassemia despite their Norwegian origin were analyzed using DNA sequencing or qPCR CNV analysis of the α-globin gene cluster in addition to first-line diagnostics as described in Materials and Methods. Common to all patients in the study were persistent microcytosis and normal iron status (Table 3). Hb fractionation showed a normal Hb pattern in all cases, excluding high Hb A2 β-thalassemia and common Hb variants. None of the seven common α-thalassemia deletions tested for by the α-thal gap-PCR were detected in any of the patients. DNA sequencing revealed one previously described single nucleotide (nt) deletion in exon 3 of HBA2 (HBA2:c.345del), and a novel 20 bp deletion in exon 2 of HBA2 (HBA2:c.142_161delGACCTGAGCCACGGCTCTGC). qPCR CNV analysis displayed two novel large deletions, one of them covering both α-globin genes (–(NOR)), and deletion of the upstream regulatory region, including HS-40 ((αα)Aurora Borealis).
Further Characterization of Hb Bronovo [α103(G10)His→Leu; HBA2: c.311A>T] and First Report of the Homozygous State
Published in Hemoglobin, 2020
Nikita Mehta, J. Martin Johnston, Molly Hein, Benjamin R. Kipp, Lea Coon, Michelle E. Savedra, James D. Hoyer, Rong He, Aruna Rangan, Min Shi, Jennifer L. Oliveira
A 3-year-old male patient presented with persistent microcytosis and anemia. The proband and his 9-year-old sister are offspring of a Turkish mother and English father. The past medical history and physical examination were otherwise unremarkable, with no evidence of splenomegaly. The boy had two previously normal Hb electrophoreses performed at another institution. The complete blood count (CBC) data showed: RBC count of 4.9 × 1012/L, Hb of 9.7 g/dL, packed cell volume (PCV) of 0.31 L/L, mean corpuscular volume (MCV) of 63.4 fL, and RBC distribution width of 15.0%. Iron studies showed a mildly decreased ferritin of 10.2 μg/L (normal range 24.0–336.0 μg/L), iron of 82.0 μg/dL, and total iron binding capacity of 395.0 μg/dL. The degree of microcytosis and anemia was not felt to be fully explained by the mixed iron study results and further evaluation was performed.
Anemia and transfusion requirements among Ugandan children with severe malaria treated with intravenous artesunate
Published in Pediatric Hematology and Oncology, 2020
Michael T. Hawkes, Robert O. Opoka, Andrea L. Conroy, Robyn E. Elphinstone, Heather A. Hume, Sophie Namasopo, Kevin C. Kain
Uganda is a high burden country for malaria and anemia, with a prevalence of anemia (Hb < 110g/L) among children under five in the general population reported at 72% (2006) and 60% (2009, Uganda Malaria Indicator Survey) respectively,21 compared to a global prevalence of 43% (2011).22 Our study, in a selected group of children with acute malaria, found a rate of anemia of 97% at hospital admission with 22% having life-threatening SMA. Incomplete laboratory investigations limit our ability to discern the mechanism of anemia in this cohort. Nonetheless, it is tempting to speculate on the processes underlying the anemia, based on the following observations. The microcytosis observed in our cohort may be due to iron deficiency and/or alpha-thalassemia, common in children under 5 in low-income settings.21,23 Similarly, microcytic hypochromic anemia accounted for 38% of all anemia cases among children hospitalized in a recent study from Tanzania24 andiron supplementation improved hematologic abnormalities in children with acute falciparum malaria in a recent clinical trial.25 In addition, jaundice, tea-colored urine, elevated admission LDH, and low haptoglobin, particularly in those the lowest Hb levels and prior to intravenous artesunate exposure, suggest that parasite-induced hemolysis may have contributed to severe anemia at presentation. The frequent observation of nucleated RBCs and high RDW at admission, which reduced significantly by day 14, may indicate an acute marrow stress response.