China 
Africa 
Explore chapters and articles related to this topic
Diagnostics
Published in Ronald Fayer, Lihua Xiao, Cryptosporidium and Cryptosporidiosis, 2007
Quantitative real-time PCR methods use patented technologies (e.g., TaqMan™, Applied Biosystems; LightCycler™, Roche Molecular Biochemicals). For both technologies, fluorogenic dyes are incorporated into the amplicon during PCR; thus, amplicon fluorescence increases as more PCR product is generated. Both systems can detect PCR products during the initial cycles of the PCR reaction when amplification is exponential, thus enabling quantitative analysis of fluorescent product. Quantitative real-time PCR methods have been used to identify different Cryptosporidium species by exploiting the genetic polymorphism of the 18S rRNA gene for devising probes with differing melting temperatures, and for the quantitative detection of Cryptosporidium oocysts in environmental water samples and sewage. The increased sensitivity of real-time PCR guarantees increased speed of detection and qualitative diagnosis; also, the quantitative nature of the assay will be invaluable in estimating levels of contamination. The “closed-tube” assay format reduces the danger of contamination from “carry over.” Quantitative realtime PCR should be a useful tool for the future, once problems related to matrix inhibition are overcome. Currently, there are no standardized quantitative real-time PCR methods.
Molecular Diagnostic Solutions in Algal Cultivation Systems
Published in Stephen P. Slocombe, John R. Benemann, Microalgal Production, 2017
Laura T. Carney, Robert C. McBride, Val H. Smith, Todd W. Lane
Quantitative PCR (qPCR) is one of the more common molecular diagnostic techniques for the detection of known deleterious species (for review, see Botes et al. 2013). qPCR can be an essential tool for conducting reactive management strategies (see Section 7.2.1; McBride et al. 2014), where a biocontaminant is isolated, identified, and targeted for routine monitoring (Figure 8.4). Two different reporter systems for qPCR are in general use: fluorogenic dyes or fluorescent oligonucleotide probes. The first system (Ponchel et al. 2003) utilizes dyes, such as SYBR green, which fluoresce when bound to the double-stranded product of PCR reactions allowing quantification of the product. The limitation of this system is that the dye binds nonspecifically to any double-stranded DNA including primer dimers. The major advantage of the fluorogenic dye–based system is that it is less expensive than the probe-based system, both to design and optimize the probes and to run the reactions. Probe-based systems (often referred to as TaqMan) utilize a fluorescently labeled oligonucleotide that binds to the desired target product (Holland et al. 1991). This allows for greater specificity and enables quantification of the target even in the presence of nontarget amplicons. In addition, probe-based systems can be multiplexed for the detection of multiple species. The disadvantage of such systems is that the reactions are more expensive because of the requirement for the labeled oligonucleotide probe and are technically more challenging, as optimizing multiplexed probes is substantively more complex and time-consuming than single primers and more sensitive to interference from unpredictable environmental samples.
Metagenomics
Published in Ram Chandra, R.C. Sobti, Microbes for Sustainable Development and Bioremediation, 2019
Gaurav Saxena, Narendra Kumar, Nandkishor More, Ram Naresh Bharagava
Quantitative PCR (Q-PCR), or real-time PCR, has been used in microbial investigations to measure the abundance and expression of taxonomic and functional gene markers (Bustin et al. 2005; Smith and Osborn 2009). Unlike traditional PCR, which relies on endpoint detection of amplified genes, Q-PCR uses either intercalating fluorescent dyes such as SYBR Green or fluorescent probes (TaqMan) to measure the accumulation of amplicons in real time during each cycle of the PCR. The software records the increase in amplicon concentration during the early exponential phase of amplification, which enables the quantification of genes (or transcripts) when they are proportional to the starting template concentration. When Q-PCR is coupled with a preceding reverse transcription (RT) reaction, it can be used to quantify gene expression (RT-Q-PCR). Q-PCR is highly sensitive to starting template concentration and measures template abundance in a large dynamic range of around six orders of magnitude. Several sets of 16S and 5.8S rRNA gene primers have been designed for rapid Q-PCR-based quantification of soil bacterial and fungal microbial communities (Fierer et al. 2005). Q-PCR has also been successfully used in environmental samples for quantitative detection of important physiological groups of bacteria such as ammonia oxidizers, methane oxidizers, and sulfate reducers by targeting amoA, pmoA, and dsrA genes, respectively (Foti et al. 2007). Kolb et al. (2003) estimated the abundance of total methanotrophic population and specific groups of methanotrophs in a flooded rice field soil by Q-PCR assay of the pmoA genes. The total population of methanotrophs was found to be 5×106 pmoA molecules g–1, and Methylosinus (2.7×106 pmoA molecules g–1) and Methylobacter/Methylosarcina groups (2.0×106 pmoA molecules g–1) were the dominant methanotrophs. The Methylocapsa group was below the detection limit of Q-PCR (1.9×104 pmoA molecules g–1).
Attenuation of streptozotocin induced high fat diet exacerbated dyslipidemia mediated hepatic and aortic injuries in male pigs by camel milk
Published in Egyptian Journal of Basic and Applied Sciences, 2023
Hadiza Bello Rilwan, Sunday Samuel Adebisi, James Abrak Timbuak, Sunday Blessing Oladele, Aliyu Muhammad, Wusa Makena, Adamu Abubakar Sadeeq
The expression levels of the LOX-1 gene in the aorta of the different experimental groups were compared using a relative quantification assay of LOX-1 mRNA performed by real-time PCR (Gene Bank ID: NM_213805.1). According to the manufacturer’s instructions, the RiboPure Extraction kit was used to extract total RNA from pig aorta tissues. A high-capacity cDNA reverse transcription kit with an RNAase inhibitor was used to make complementary DNA (cDNA) (Applied Biosystems, USA). TaqMan labeled primers and probes were used for the target genes in gene expression assays. Forward primer sequence (5’ to 3’) used for LOX-1 was TCGGAGTGAACGGATTTGGC and reverse primer sequence TGACAAGCTTCCCGTTCTCC. As an endogenous control, GAPDH as the housekeeping gene (Gene Bank ID: NM_213805.1) was used, the forward primer sequence (5’ to 3’) used for GAPDH was AGTCTTTCCACTCTGCGGTG and reverse primer sequence GGTCACCAGTAATCCCAGGC. All primers and probes were obtained from Applied Biosystems in the United States. The target mRNA was quantified by comparing the total RNA added to each reaction and normalizing it with endogenous control as an active reference. The following cycling conditions were used for PCR reactions: 1 cycle at 50°C for 2 minutes, 1 cycle at 95°C for 10 minutes, 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Relative real-time PCR was used for relative quantification. The real-time PCR technique estimates gene expression levels simultaneously during real-time PCR amplification and at the end of the experiment.
Developing mitochondrial DNA field-compatible tests
Published in Critical Reviews in Environmental Science and Technology, 2022
Bidhan C. Dhar, Christina E. Roche, Jay F. Levine
Quantitative real-time PCR depends on PCR methods and determines the quantity of PCR amplicons for every amplification cycle utilizing a fluorescent reading (Bustin et al., 2009). Signal identification in fluorescence-based qPCR or isothermal amplification is presently dependent on the fluorescence radiated by fluorescently marked probes or colors with intercalation. Probes such as TaqMan are sequence-specific oligos coupled with DNA-binding dyes such as FAM, which are read at various wavelengths (Holland et al., 1991; Rong et al., 2018). Non-sequence-specific double-stranded DNA-binding dyes, such as SYBR green can also be used (Xu et al., 2015; Zhu & Coffman, 2017). However, the detection typically depends on relatively expensive instrumentation, which requires training for competence and reagent sample costs that increase the overall cost of the assay.
Assays and enumeration of bioaerosols-traditional approaches to modern practices
Published in Aerosol Science and Technology, 2020
Maria D. King, Ronald E. Lacey, Hyoungmook Pak, Andrew Fearing, Gabriela Ramos, Tatiana Baig, Brooke Smith, Alexandra Koustova
Real-time quantitative polymerase chain reaction (qPCR) is a widely used method for the detection, quantification, and typing of different microbial agents (He and Yao 2011; Kralik and Ricchi 2017). It is also used to compare gene transcription levels (Saint-Marcoux et al. 2015). By simple definition, qPCR is the process of amplifying DNA, using fluorescent (SYBR® Green) dye to detect the dsDNA PCR product as it accumulates during PCR and intercalates with the dye. However, these dyes detect the accumulation of both specific and nonspecific PCR products. To improve the specificity of the detection, fluorogenic-labeled probes (TaqMan) have been introduced that use the 5’ nuclease activity of Taq DNA polymerase (Holland et al. 1991; Georgakopoulos et al. 2009). A probe containing a fluorescent reporter dye on the 5’ end and a quencher dye on the 3’ end anneals downstream from one of the primer sites and is cleaved by the 5’ nuclease activity of Taq DNA polymerase as this primer is extended. The cleavage of the probe separates the reporter dye from the quencher dye, increasing the fluorescence emitted by the reporter dye. Due to its simpler process and lower cost, SYBR® Green assays are more applied (Libert et al. 2015). The steps of qPCR are the same as for conventional PCR, including DNA denaturation, primer annealing, and extension (Kralik and Ricchi 2017).