China
Africa
Explore chapters and articles related to this topic
Structures
Published in Thomas M. Nordlund, Peter M. Hoffmann, Quantitative Understanding of Biosystems, 2019
Thomas M. Nordlund, Peter M. Hoffmann
Many ribozymes have either a hairpin- or hammerhead-shaped active center and a unique secondary structure that allows them to cleave other RNA molecules at specific sequences. It is now possible to make ribozymes that will specifically cleave any RNA molecule. These RNA catalysts may have pharmaceutical applications. For example, a ribozyme has been designed to cleave the RNA of human immunodeficiency virus (HIV). If such a ribozyme was made by a cell, all incoming virus particles would have their RNA genome cleaved by the ribozyme, which would prevent infection. Some known ribozymes include peptidyl transferase 23S rRNA, RNase P, Group I and Group II introns, GIR1 branching ribozyme, leadzyme, hairpin ribozyme, hammerhead ribozyme, HDV ribozyme, mammalian CPEB3 ribozyme, VS ribozyme, glmS ribozyme, and CoTC ribozyme. The hammerhead ribozyme is probably the most well known.
SARS-CoV-2 Inactivation by Ozonated Water: A Preliminary Alternative for Environmental Disinfection
Published in Ozone: Science & Engineering, 2021
Ronaldo B. Martins, Italo A. Castro, Marjorie Pontelli, Juliano P. Souza, Thais M. Lima, Stella Rezende Melo, João Paulo Zen Siqueira, Maicon Henrique Caetano, Eurico Arruda, Margarete Teresa Gottardo de Almeida
Titration of infectious SARS-CoV-2 showed a significant reduction in virus infectivity upon 1 min exposure to ozonated water and alcohol, with, respectively, 2 and 2.8 log10 reductions as compared to the virus in DMEM (Figure 1A). The quantification of the virus genome upon exposure to ozonated water for 1 min indicated no reduction in genome quantification as compared to milli-Q water. Treatment with alcohol caused roughly 70% reduction of the virus genome (Figure 1B). However, the SARS-CoV-2 RNA quantification in supernatants from Vero CCL-81 cells infected with the remainder of the virus treated with ozonated water and ethylic alcohol revealed a significant reduction in genome copies (p < 0.05) of progeny SARS-CoV-2 per copy of housekeeping gene RNase-P as compared to milli-Q water (Figure 1C). Taken together, these results suggest that ozonated water, at this concentration, inactivates SARS-CoV-2 by a mechanism targeting its structure, and not the virus genome.
Ex vivo treatment with fucoidan of mononuclear cells from SARS-CoV-2 infected patients
Published in International Journal of Environmental Health Research, 2022
K. J. G. Díaz-Resendiz, G. A. Toledo-Ibarra, R. Ruiz-Manzano, D.A. Giron Perez, C.E. Covantes-Rosales, A. B. Benitez-Trinidad, K. M Ramirez-Ibarra, A. T. Hermosillo Escobedo, I. González-Navarro, G.H. Ventura-Ramón, A. Romero Castro, D. Alam Escamilla, A. Y. Bueno-Duran, Manuel Iván Girón-Pérez
Methods, reagents, kits, and procedures for SARS-CoV-2 detection were approved by Mexican health authorities (Mexican Health Ministry, Secretaría de Salud de México, and the InDRE). Inactivation and total RNA extraction were made with RNA extraction by QIAmp Viral RNA Mini Kit (Qiagen, Cat No./ID: 1,020,953 USA, Germantown) with 140 μL of VTM from swabbing VTM. qRT-PCR procedure was performed according to the Berlin protocol with modifications (Corman et al. 2020a). Briefly, The RT-PCR reaction was performed using the SuperScriptTM III PlatinumTM One-Step qRT-PCR Kit (Invitrogen, Cat No./ID: 11,732–088, USA), with the extracted RNA from both types of samples and for the SARS-CoV-2 detection for viral E gene E_Sarbeco_Forward: ACAGGTACGTTAATAGTTAATAGCGT, E_Sarbeco_Reverse: ATATTGCAGCAGTACGCACACA, TaqMan probe E_Sarbeco_P1: FAMCACTAGCCATCCTTACTGCGCTTCG-BBQ), and as a control RNase P gene (RNAseP Forward: AGATTTGGACCTGCGAGCG, RNAseP Reverse, GAGCGGCTGTCTCCACAAGT, TaqMan probe RNAseP P1, FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1) (Hasan et al. 2020; Corman et al. 2020b). The qRT-PCR was performed with 5 μL (≈70 ng/μL) of extracted RNA in a total 25 μL reaction. All samples were analyzed in the 7500 Fast Real-Time PCR System (Applied-Biosystem) with the protocol: 50°C for 15 min, 95°C for 2 min and then 45 cycles of 95°C for 15 seconds and 60°C for 30 seconds. In all cases, human gene (RNAseP) amplification was used as an internal control, and samples were considered as positive if its Ct value (number of cycles needed for the fluorescent signal to cross the threshold or cycle threshold) was equal or lower than 38.