China
Africa
Explore chapters and articles related to this topic
Physiology and Growth
Published in Paul Pumpens, Single-Stranded RNA Phages, 2020
As an alternate method of the phage MS2 purification by chromatography, calcium phosphate columns were proposed (Cernohorský et al. 1968). Then, the molecular sieve chromatography on an agarose column was used for the purification of the phage MS2 (Yoshinaga and Shimomura 1971). The phage MS2 was concentrated also by charge-modified filter chromatography: phage lysates were first clarified by filtration through serum-coated membrane filters, then the clarified lysate was adjusted to pH 6 and passed through a Zeta-plus filter (30 S size); greater than 99% phage adsorption occurred under these conditions and adsorbed phage was successfully eluted (Goyal et al. 1980a). The phages f2 and MS2 were involved, together with a set of the DNA phages, in thorough studies on the potential application of DEAE sepharose and octyl-sepharose column chromatography for the purification of viruses (Shields and Farrah 2002).
Steroid Hormones, Hormone Secretion, and Steroid Receptors in Carcinogenesis
Published in Velibor Krsmanović, James F. Whitfield, Malignant Cell Secretion, 2019
Radmila Djordjević-Marković, Dušan T. Kanazir
The liver and thymus cytosol glucocorticoid receptors have been purified, in our laboratory, to homogeneity by sequential chromatography on phosphocellulose, DNA-cellulose, and DEAE-Sepharose® (three-step purification procedure).34,53 The activated GR preparation, obtained after the final purification, contains a 94-kDa glucocorticoid binding protein as the dominant component and a 72-kDa co-purifying protein of unknown function, and perhaps a 24-kDa component of unknown composition. The 94-kDa steroid-binding GR subunit is phosphorylated in a number of tissues.34,53,64,65 Phosphorylation of GR might play some role in the regulation of GR functions, such as hormone binding and activation.21,64,65
CDC42Hs: The Human Homolog of a Yeast Cell-Division Cycle Protein
Published in Juan Carlos Lacal, Frank McCormick, The ras Superfamily of GTPases, 2017
Matthew J. Hart, David Leonard, Katsuhiro Shinjo, Tony Evans, Richard A. Cerione
The 22-kDa phosphosubstrate was purified following its solubilization from bovine brain membranes using a series of chromatographic steps which included DEAE-Sepharose, Ultrogel AcA34, phenyl-Sepharose, hydroxy apatite, and FPLC/Mono-Q chromatography. The guanine nucleotide-dependent, EGF-stimulated phosphorylation reaction was used as an assay for the 22-kDa protein during these purification steps. When the highly purified 22-kDa protein was coinserted into phosphatidylcholine vesicles with the purified, human placental EGF receptor, a highly effective, EGF-stimulated phosphorylation of the 22-kDa protein was observed (Figure 1A) with stoichiometrics of 32Pi incorporation approaching 2 mol 32Pi per mol [35S]GTPγS binding activity. Phosphoamino acid analyses showed that the phosphorylation of the 22-kDa protein in these reconstituted systems occurred exclusively on tyrosine residues, as was also the case for the EGF receptor autophosphorylation reaction (Figure IB).
Comparative study on the performance of monoolein cubic nanoparticles and trimyristin solid lipid nanoparticles as carriers for docetaxel
Published in Pharmaceutical Development and Technology, 2023
Mohamed Dawoud, Mariam Mojally, Randa Abdou, Hany G. Attia
Instead of using the conventional methods, an ion exchange column technique was used to measure the release of docetaxel from the different nanoparticles as donors to the acceptor SUVs which mimic the body’s cell membranes (Fahr et al. 2005; Fahr and Liu 2010; Dawoud 2013, 2015; D'Addio et al. 2016; Dawoud and Abdou 2022). 50 ml of DEAE-sepharose was washed twice with 150 ml tris buffer. A third washing step was performed with 150 ml sucrose buffer and finally the gel was diluted 1:1 with sucrose buffer. 1 ml of the gel was packed in the columns after clogging them with a piece of glass wool. For efficient packing of the columns, 2 ml of sucrose buffer was eluted. To avoid the adsorption of donor nanoparticles on the gel, a saturation step was carried out by eluting 20 µl of docetaxel free SLNs and cubosomes with 1.5 ml sucrose buffer. After this saturation step, the columns were ready for the transfer experiments and for the separation between the donor SLNs or cubosomes and the acceptor SUVs. Different amounts of the donor nanoparticles (SLNs or cubosomes) were mixed with different amounts of the acceptor SUVs in Eppendorf tubes and the volume was adjusted to 500 µl with sucrose buffer. To evaluate the effect of the lipid ratios between the donor and acceptor on the transfer rate of docetaxel, the transfer experiments were carried out with two lipid molar ratios 1:25 and 1:100 (donor: acceptor).
Dialysis-related amyloidosis associated with a novel β2-microglobulin variant
Published in Amyloid, 2021
Hiroki Mizuno, Junichi Hoshino, Masatomo So, Yuta Kogure, Takeshi Fujii, Yoshifumi Ubara, Kenmei Takaichi, Tetsuko Nakaniwa, Hideaki Tanaka, Genji Kurisu, Fuyuki Kametani, Mayuko Nakagawa, Tsuneaki Yoshinaga, Yoshiki Sekijima, Keiichi Higuchi, Yuji Goto, Masahide Yazaki
The plasmid pColdB2M was constructed by excising the WT B2M gene from the plasmid pHikaru1A using NdeI and SalI, and cloning the fragment into pColdIV (Takara, Shiga, Japan). A V27M mutant β2m was constructed by site-directed mutagenesis using the following primers: 5′CTGAATTGCTATATGTCTGGGTTTCATC3′ (forward) and 5′GATGAAACCCAGACATATAGCAATTCAG3′ (reverse). Proteins were expressed in Escherichia coli strain BL21-DE3 and purified as described previously [15]. Briefly, inclusion bodies were solubilised with 8 M urea in 20 mM Tris-HCl (pH 8.0). The disulphide bond was chemically oxidised with 1,1′-azobis (N, N-dimethylformamide) and confirmed by reversed-phase chromatography. Proteins were purified by anion exchange chromatography using DEAE Sepharose FF (GE Healthcare, Little Chalfont, UK) and Resource Q (GE Healthcare, Little Chalfont, UK) columns. Purified proteins were lyophilised, and the molecular weights were confirmed by MS.
Arca subcrenata Polypeptides Inhibit Human Colorectal Cancer HT-29 Cells Growth via Suppression of IGF-1R/Akt/mTOR Signaling and ATP Production
Published in Nutrition and Cancer, 2020
Xianjing Hu, Weiming Zheng, Yuanyuan Luo, Xiaozheng Ou, Liyan Song, Sirui Zhang, Tingsha He, Zhongyi Guo, Jianhua Zhu, Hui Shi, Weijuan Huang, Rongmin Yu
The effluent PAS fraction was purified through a diethyl-aminoethanol (DEAE)-sepharose fast flow anion exchange column. The results of the purification process and electrophoresis are shown in Fig. 1, and the contents of PAS were 74.56% (w/w) of protein and 22.46% of sugar. Furthermore, the polypeptide composition of PAS was analyzed and sequenced using tandem mass spectrometry (MS/MS) aligning with the protein sequence database which was set up by transcriptome of A. subcrenata. Comparing with the NCBI BLAST database about amino acid sequences information, it was concluded that PAS was mainly made of arginine kinase, cartilage matrix protein-like isoform X1, retinal dehydrogenase 1-like isoform X2, and sarcoplasmic calcium-binding protein-like isoform X1.