China
Africa
Explore chapters and articles related to this topic
Expression
Published in Paul Pumpens, Single-Stranded RNA Phages, 2020
The well-studied initiation signals of the RNA phages with their well-established Shine-Dalgarno sequences (for detail, see Chapter 16) were tested for their efficiency with heterologous genes. Thus, Looman et al. (1985) employed the ribosome binding sites of the MS2 and Qβ maturation proteins by the studies on the transcription and translation of the lacZ gene of E. coli. The highest β-galactosidase production was found in the clone with the Qβ A2 initiation site and the lowest amount in those containing the initiation of the MS2 maturation protein, although the latter possessed the longest Shine-Dalgarno sequence but contained GUG instead of AUG as the initiation codon. Changing the GUG into AUG resulted in a threefold increase in the expression level (Looman and van Knippenberg 1986). No strict correlation was found between the level of the lac mRNA and β-galactosidase production, and the translation, but not the transcription, appeared to be most efficient when the homologous lacZ initiation signal was present when the outcome was calculated per molecule of the lac mRNA (Looman et al. 1985). When more different ribosome binding sites were used for the expression of the model lacZ gene in parallel with the above-mentioned ones, namely, those of the Qβ replicase, MS2 replicase, Qβ coat, and MS2 coat, Looman et al. (1986) concluded that the secondary structure was the primary determinant of their efficiency in E. coli. The Shine-Dalgarno sequence and the length and sequence of the spacer region up to the initiation codon alone were not able to explain the observed translation efficiency. The deletion mutations created in the Qβ replicase ribosome binding site revealed a complex pattern of control of expression, probably involving the use of a “false” initiation site (Looman et al. 1986).
Akkermansia muciniphila upregulates genes involved in maintaining the intestinal barrier function via ADP-heptose-dependent activation of the ALPK1/TIFA pathway
Published in Gut Microbes, 2022
Camille Martin-Gallausiaux, Diego Garcia-Weber, Amandine Lashermes, Pierre Larraufie, Ludovica Marinelli, Veronica Teixeira, Alice Rolland, Fabienne Béguet-Crespel, Vincent Brochard, Timothé Quatremare, Alexandre Jamet, Joël Doré, Scott D. Gray-Owen, Hervé M. Blottière, Cécile Arrieumerlou, Nicolas Lapaque
E. coli K-12 WT and ΔHldE E. coli (JW3024) are from the Keio collection49 (Dharmacon). hldE from A. muciniphila was amplified using the following primers: (i) AhldEfor_NheI (5’-GGGGGCTAGCAGGAGGTAAATAATGAACCGGCTGCATACAT-3’) creating a new NheI restriction site (GCTAGC) and adding a Shine-Dalgarno sequence (AGGAGG) located 6 bases upstream of the start codon ATG and (ii) AhldErev_HindIII (5’-GGGGAAGCTTTCATTCCGGGCTGCTTTTC-3’) creating a new HindIII restriction site (AAGCTT). The 1523 pb fragment was amplified using Phusion High-Fidelity DNA polymerase, A-tail with GoTaq polymerase and cloned in pGEM®-T Easy vector (Promega Corporation) to generate pGEM-T-AhldE. After NheI HindIII restriction of the pGEM-T-AhldE, the AhldE fragment was cloned into NheI-HindIII-restricted pBAD24 generated pBAD24-AhldE vector (amp). pBAD24-AhldE and the empty vector pBAD24 were purified and used to electroporate E. coli ΔHldE. Overnight bacterial cultured were washed in PBS and resuspended at an OD = 1, boiled for 30 min and stored at -20°C until use.
Strategies for targeting RNA with small molecule drugs
Published in Expert Opinion on Drug Discovery, 2023
Christopher L. Haga, Donald G. Phinney
Although we think of RNA-binding small molecules as rather recent discoveries, their history dates to the mid-20th century [31]. In the 1940s and 1950s, bacterially derived aminoglycosides such as streptomycin, neomycin, and paromomycin were found to possess antibacterial properties through an unexplained mechanism. However, later research demonstrated that these aminoglycosides interacted with ribosomal RNA (rRNA) [32]. In prokaryotes, protein synthesis is carried out in three distinct phases: initiation, elongation, and termination. During the initiation phase, the initiation complex, composed of the small 30S ribosome, initiation factors, and initiator tRNA, interacts with the bacterial mRNA at the Shine-Dalgarno sequence upstream of the start codon. This small 30S ribosome itself is composed of 16S rRNA in complex with 19 other proteins and is responsible for proofreading during protein initiation and elongation, ensuring only the correct amino acid is incorporated into the elongating polypeptide. The tRNA substrates pass through three distinct binding sites on the ribosome during protein synthesis: aminoacyl (A), peptidyl (P), and exit (E). Contact between the tRNA codon and the aminoacyl-tRNA anticodon (A site) is formed by a highly conserved rRNA sequence and is implicated in the preservation of fidelity. Aminoglycoside-based antibiotics disrupt protein synthesis by binding to conserved regions of the rRNA A site distorting structural adenosine ribonucleotide residues in an internal RNA loop [33]. This bulges adenosine residues A1492 and A1493, inducing solvent accessibility on the minor groove of the RNA internal loop structure resulting in deformation of the A site. Distortion of the A site by aminoglycoside interactions impede its native proofreading ability allowing for the incorporation of non-cognate tRNAs into the elongating polypeptide chain. This mistranslation results in clusters of errors in full-length proteins and, ultimately, bacterial cell death by proteotoxic stress. Given that aminoglycosides readily bind to rRNA, it is not surprising to find that aminoglycosides have been shown to bind to other classes of RNA that share similar structural motifs such as miRNAs [34] and the so-called kissing loop RNA complex from the dimerization initiation site (DIS) and Rev response element (RRE) from HIV-1 [35].
Virulence-attenuated Salmonella engineered to secrete immunomodulators reduce tumour growth and increase survival in an autochthonous mouse model of breast cancer
Published in Journal of Drug Targeting, 2021
Lance B. Augustin, Liming Milbauer, Sara E. Hastings, Arnold S. Leonard, Daniel A. Saltzman, Janet L. Schottel
The plasmids used in this study were designed to express and secrete various immunomodulators that could be tested for anticancer therapy (Table 1). The plasmids were constructed by replacing the Trc promoter and LacZalpha sequence in plasmid pYA292 [15] with an FF+20* [16] promoted operon. The FF+20* promoter was used for tumour-specific gene expression. The operon consisted of the FF+20* promoter, an immunomodulator cDNA sequence in frame with a C-terminal 60 amino acid E. coli HlyA secretion signal [17], which was followed by cDNA sequences coding for the E. coli haemolysin secretion proteins HlyB and HlyD (Figure 1). Plasmids pFF+20*IL-15Hly, pFF+20*αCTLA-4Hly and pFF+20*αPD-L1Hly, including their complete DNA sequences, were deposited at Addgene. The IL-15 sequence in pFF+20*IL-15Hly is modelled from RLI [9]. The murine IL-15Rα sushi domain, isolated by PCR from plasmid pORF9-mIL15RAa (InvivoGen cat. porf-mIL15raa), was joined through the 20 amino acid RLI flexible linker to cDNA coding for the murine IL-15 gene, which was isolated by PCR from plasmid pORF9-mIL15 (InvivoGen cat. porf-mIL15). A second 18 amino acid glycine/serine-rich flexible linker, GQSSRSSGGGGSSGGGGS [18], was used to join the C-terminal amino acid of IL-15 to 60 amino acids at the C-terminus of the HlyA signal sequence. The anti-CTLA-4 and anti-PD-L1 scFv cDNA sequences, including C-terminal 6xHistidine and haemagglutinin tags, were isolated from immunised chicken antibody libraries as described previously [19]. They were joined at their C-terminal amino acid directly to the C-terminal 60 amino acid HlyA signal sequence. The E. coli haemolysin operon sequence in each of the immunomodulator plasmids was isolated by PCR from plasmid pNirB-PAop-hlyAs [20] using forward and reverse primers TTAGCCTATGGAAGTCAGGGTAATC and TTAACGCTCATGTAAACTTTCTGTTAC, respectively. For western analysis of immunomodulator expression and secretion, the FF+20* promoter and sequence immediately upstream from the consensus AGGAGG Shine-Dalgarno sequence were replaced by sequence containing the LacUV5 promoter [21] in pLacUV5IL-15Hly AGATCTTCCGGAAGACCTTCCATTCTGAAATGAGCTGTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAAT, as well as the Trc promoter [22] in pTrcαCTLA-4Hly and pTrcαPD-L1Hly AGATCTTCCGGAAGACCTTCCATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACAAT.