China
Africa
Explore chapters and articles related to this topic
Target Amplification-Based Techniques
Published in Attila Lorincz, Nucleic Acid Testing for Human Disease, 2016
Antoinette A.T.P. Brink, Peter J.F. Snijders, Chris J.L.M. Meijer
As soon as Taq polymerase was introduced, use of PCR increased remarkably. Nowadays, thermostable DNA polymerases of other bacteria are also available for this purpose. The best known of these are Pfu DNA polymerase (from Pyrococcus furiosus) and , (New England Biolabs, Ipswich, Massachusetts, USA, http://www.neb.com) DNA polymerase (from Thermococcus litoralis). Pfu polymerase has a very low base incorporation error rate and therefore serves as the polymerase of choice when the PCR product must be free of point mutations. Vent polymerase has a half-life at 95°C that exceeds the half-life of Taq polymerase by a factor of 4 and can therefore be used for amplification of target sequences with high numbers of secondary structures. However, DNA polymerases other than Taq generally are more difficult to handle and more expensive.
Mitochondrial DNA deletions in tissues of mice after ionizing radiation exposure
Published in International Journal of Radiation Biology, 2018
Valeriya N. Antipova, Milena G. Lomaeva, Nadezhda V. Zyrina
The polymerase chain reaction (PCR) was performed with the primers F 5′/AACAGTAACATCAAACCGACCAGG/3′ (Ikushima et al. 2002) and R 5′/TGACTGTATGGTGTATGTCAGAT/3′ (Takeda et al. 2000) to detect mtDNA deletions. The PCR parameters for amplification of the 8080 base pair mtDNA fragments were set as follows: predenaturation at 94 °C for 4 min; 35 cycles of denaturation at 94 °C for 30 s, annealing with a subsequent extension at 68˚C for 8 min; and a final extension at 72 °C for 10 min. 25 μL of reaction mix contained: 75 mM Tris-HCl, рН 8.8, 20 mM (NH4)2SO4, 2.5 mM МgCl2, 200 μM of each dNTP, 250 nM of each primer, 0.01% Tween-20, 100 ng of DNA and 0.5 U of a Taq: Pfu DNA polymerase mix at the ratio of 16:1. Reactions were performed in the Tercyc Multi-block Thermocycler (DNA-Technology, Moscow, Russia). The PCR products were separated in 1% agarose and stained by ethidium bromide (0.5 mg/L) for 40 min. Fluorescence imaging of the PCR products was performed using UVP FirstLight UV Transilluminator (UVP Inc., Upland, California, USA) in accordance with the DOC-Print DP-001-FDC gel documentation system (Vilber Lourmat, Marne La Vallée, France) or a gel documentation system (DeltaTekh Ltd, Moscow, Russia).
Modulation of the gut microbiota by metformin improves metabolic profiles in aged obese mice
Published in Gut Microbes, 2018
Heetae Lee, Youngjoo Lee, Jiyeon Kim, Jinho An, Sungwon Lee, Hyunseok Kong, Youngcheon Song, Chong-Kil Lee, Kyungjae Kim
Total DNA was extracted using a PowerSoil DNA Isolation Kit (MO BIO Laboratories Inc.) from cecum samples including fecal materials. Amplification of partial sequences of 16S rRNA genes was performed based on a 16S rRNA amplification protocol from the Earth Microbiome Project.46 16S rRNA genes were amplified using the 515F/806R primer set, which includes an adapter sequence for amplification of the V4 region (515F forward primer: 5′-TCG TCG GCA GCG TCA GAT GTG TAT AAG AGA CAG GTG CCA GCM GCC GCG GTA A- 5′; 806R reverse primer: 5′-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGG ACT ACH VGG GTW TCT AAT). To attach the dual indices and adapter to amplified polymerase chain reaction (PCR) products, index PCR was performed using an AmpONE™ α-Pfu DNA polymerase (GeneAll, Korea) and Nextera® XT Index Kit v2 (Illumina). PCR products after amplification and attach were purified using the Expin™ PCR SV (GeneAll, Korea). Sequencing of partial bacterial 16S rRNA genes was performed using the MiSeq Reagent Kit V3 (600 cycles) and MiSeq platform (Illumina) at KoBioLabs Inc.
A high frequency missense SULT1B1 allelic variant (L145V) selectively expressed in African descendants exhibits altered kinetic properties
Published in Xenobiotica, 2018
Zachary E. Tibbs, Amber L. Guidry, Josie L. Falany, Susan A. Kadlubar, Charles N. Falany
Normal human endometrium was obtained from the University of Alabama at Birmingham (UAB) Tissue Procurement Center. Total RNA was isolated from tissue using RNA-STAT 60 (Tel-Test Inc., Friendswood, TX). Following RNA isolation, 4 μg of the total RNA sample served as the template for Invitrogen Superscript III reverse-transcriptase to synthesize cDNA. To amplify SULT1B1, 10% of this reaction volume was used as the template for PCR by Pfu DNA polymerase using the sense primer 5′-CTGAACAAAGGGATTAAATTGTGAGAACAACTGTC-3′ and antisense primer 5′-GAGATTGTCTGTAGTTGATTGAAACGAGGGCA-3′ (30 cycles, manufacturer protocol). The PCR product (1021 bp) was subsequently purified by 1% agarose-gel electrophoresis and sequenced in the UAB Heflin Sequencing Core. Two distinct sequences, one with GTA and the other with TTA encoding the 145th amino acid were identified. This variation (rs11569736) resulted in the introduction of a new unique recognition site for the restriction enzyme HpyCH4IV (A↓CGT). Therefore, the DNA was digested with 20 units of HpyCH4IV, and the base alteration confirmed with electrophoresis.