China
Africa
Explore chapters and articles related to this topic
Pesticides and Chronic Diseases
Published in William J. Rea, Kalpana D. Patel, Reversibility of Chronic Disease and Hypersensitivity, Volume 4, 2017
William J. Rea, Kalpana D. Patel
These herbicides include dinitrophenol (Chemox PE), dinitrocresol (DNOC, DNC, Sinox, Chemsect DNOC, Elgetol 30, Nitrador, Selinon, Trifocide), dinoseb (DNBP, Dinitro, Basanite, Caldon, Chemox General, Chemox PE, Chemsect DNBP, Dinitro-3, Dinitro General, Dow General Weed Killer, Dow Selective Weed Killer, Dynamyte, Elgetol 318, Gebutox, Kiloseb, Nitropone C, Premerge 3, Sinox General, Subitex, Unicrop DNBP, Vertac Dinitro Weed Killer), dinosam (DNAP), dinoprop, dinoterbon, dinosulfon, binapacryl (Morocide, Endosan, Ambox, Dapacryl), dinobuton (Acrex, Dessin, Dinofen, Drawinol, Talan), and dinopenton, dinocap (Crotone, Karathane). Several combinations are widely used: Dyanap and Klen Krop = dinoseb + naptalam; Ancrack = sodium salts of dinoseb + naptalam; Naptro = dinitrophenol + naptalam.
Cronobacter: Virulence and Pathogenesis
Published in Dongyou Liu, Laboratory Models for Foodborne Infections, 2017
Several selective media for detecting Cronobacter have been developed [8,9]. However, these media are insufficient to support the growth of all strains of Cronobacter [10]. To detect Cronobacterspp. in powdered infant formula, a one-step enrichment protocol using a chromogenic medium has been designed [11]. More useful molecular-based detection techniques for understanding the epidemiology of Cronobacter have also been developed by targeting a number of genes such as 16S rRNA, 16S-23S rRNA intergenic regions, ompA, zinc-containing metalloprotease, dnaG and gluA genes by real-time polymerase chain reaction (PCR) [12–15]. Genes that are unique to different species of Cronobacter are particularly useful as candidate markers in molecular detection protocols [16–18]. Due to limitations of individual gene-based techniques, whole-genome sequencing may help identify Cronobacter species and assist in comparing the genotypic and phenotypic features of the pathogen being studied.
Recent Advances in Repositioning Non-Antibiotics against Tuberculosis and other Neglected Tropical Diseases
Published in Venkatesan Jayaprakash, Daniele Castagnolo, Yusuf Özkay, Medicinal Chemistry of Neglected and Tropical Diseases, 2019
The study was based on the premise that disruption of iron acquisition is detrimental to metabolism and growth of Mtb, which has previously been correlated to antitubercular effects of gallium. To cope with iron scarcity, pathogenic microorganisms have developed efficient iron-uptake systems which involve the production of natural chelators such as siderophores. The study exploited the inability of biological systems to distinguish between Fe3+ from Ga3+ which displays binding affinity for ferric iron-binding proteins and chelators. In contrast to Fe3+, Ga3+ is not reducible under physiological conditions; therefore its insertion at active sites of iron-dependent enzymes may block their activity. It has been previously shown that gallium nitrate has potent inhibitory effects (MIC50 1.25–2.5 μM) against Mtb in the presence of 2 μM iron; however, its effects were restricted when iron was in excess. Also gallium inhibited Mtb growth within cultured human macrophages (Olakanmi et al. 2000). A subsequent investigation demonstrated that gallium is efficacious in vivo in a SCID or BALB/c mouse Mtb infection model. Moreover, gallium inhibited the activity of Mtb iron-dependent enzymes ribonucleotide reductase (crucial for DNA synthesis) and acotinase (involved in ATP production) (Olakanmi et al. 2013). Other authors reported the antitubercular efficacy of gefitinib 66, an epidermal growth factor receptor inhibitor that is used for non-small cell lung cancer therapy (Figure 6). Gefitinib restricted growth of Mtb in both J774 murine macrophages and primary mouse bone marrow-derived macrophages at a concentration of 5 μM. Moreover, gefitinib inhibited bacterial replication in the lungs of Mtb-infected mice at a dose of 100 mg/kg/day for 6 d (Stanley et al. 2014). Gajadeera et al. investigated antitubercular effects of DNA intercalators including anthracyclines such as daunorubicin 67 which exhibited pronounced activity (Figure 6). Daunorubicin exhibited potent inhibition of in vitro growth of Mtb (MIC 1.25 μM) relative to other anthracyclines and also inhibited Mtb primase DnaG which is crucial for chromosomal DNA replication and cell division (Gajadeera et al. 2015). Another anticancer drug, bis-biguanide dihydrochloride 68, has been shown to restrict extracellular and intracellular growth of M. Smegmatis and M. bovis BCG (Figure 6). The anticancer agent has also shown high potency against clinically isolated Mtb (MIC 0.05 μg/mL) and MDR TB strains (≥ 0.05 μg/mL). Moreover, it reduced bacillary burden in the lung and spleen of Mtb-infected mice and also attenuated Mtb-induced lesions (Shen et al. 2016).
Efflux pump inhibitors as a promising adjunct therapy against drug resistant tuberculosis: a new strategy to revisit mycobacterial targets and repurpose old drugs
Published in Expert Review of Anti-infective Therapy, 2020
Liliana Rodrigues, Pedro Cravo, Miguel Viveiros
Doxorubicin was also one of the drugs identified by this method. This drug is an antineoplastic in the anthracycline class, used to produce regression in solid tumors and disseminated neoplastic conditions and as a component of adjuvant chemotherapy in breast cancer. However, doxorubicin can cause toxicity in multiple organs, including cardiotoxicity, which has to do with its mechanism of action [118,119]. Doxorubicin binds to nucleic acids, presumably by specific intercalation of the planar anthracycline nucleus with the DNA double helix. It may also inhibit polymerase activity, affecting regulation of gene expression, and producing free radical damage to DNA [120]. In mycobacteria, previous studies have found evidences that doxorubicin is a potent inhibitor of the DNA primase (DnaG), with an MIC of 5 μM in M. tuberculosis [121]. Our analysis revealed the NADH dehydrogenase I chain B (Rv3146) and chain D (Rv3148) as potential targets of doxorubicin in M. tuberculosis. However, it has been previously demonstrated that doxorubicin is a substrate of efflux pumps, particularly the DrrAB transporter, which undermines its potential as anti-TB drug [37]. Therefore, further studies are necessary in order to clarify the mode of action of doxorubicin in M. tuberculosis and to develop safer derivatives that are not subject to efflux.
Distribution, diversity and functional dissociation of the mac genes in marine biofilms
Published in Biofouling, 2019
Wei Ding, Weipeng Zhang, Ruojun Wang, Yanan Sun, Bite Pei, Zhaoming Gao, Pei-Yuan Qian
Once in the laboratory, the biofilms growing on Petri dishes were thoroughly rinsed with 10 ml of 0.1-μm filtered and autoclaved seawater before scraping off the Petri dishes with autoclaved cotton tips and diluting 100 times. For each biofilm, 100 µl aliquots were spread on marine broth agar plates (BD Difco 2216, New Providence, NJ, USA). Subsequently, the microbes were incubated at 22 °C for 24 h. Colonies were examined under a dissecting microscope for morphological characteristics, including size, color, shape and surface topography. Conspicuous colony types were isolated and polymerase chain reaction (PCR) was conducted to amplify the 16S rRNA genes using the 8F/1492R primers (AGAGTTTGATCCTGGCTCAG; CGGTTACCTTGTTACGACTT), followed by Sanger sequencing (BGI, Beijing, China) to identify the taxonomy of the isolates. Genome sequencing of the isolated bacteria was performed on the Illumina HiSeq 2500 platform (Novogene, Beijing, China). The Pfam database was used to annotate the bacterial genomes. Single-copy marker genes were extracted based on AMPHORA2 (Wu and Scott 2012). Three of the single-copy marker genes (dnaG, pyrG, and rpoB) were used to construct the maximum likelihood species tree of the bacteria using MEGA 7.0 (Kumar et al. 2016). The trees of the mac genes were constructed using MEGA 7.0 as well (Kumar et al. 2016). Bootstrap values were calculated based on 500 replicates.
Emergence of VIM-2-producing Citrobacter freundii in Japan
Published in Infectious Diseases, 2018
Sayaka Ando, Ryuichi Nakano, Tomokazu Kuchibiro, Katsutoshi Yamasaki, Yuki Suzuki, Akiyo Nakano, Tomoki Mizuno, Kei Kasahara, Hisakazu Yano
To confirm the transferability of blaVIM-2, mating experiments were carried out using the sodium azide-resistant Escherichia coli strain J53. Plasmid incompatibility groups were identified by the PCR-based replicon typing method [8]. The plasmid belonged to the IncW group and the transfer frequency was 1.3 × 10−6. Although the plasmid DNA was not transferred in the mating experiment, it could be electroporated into P. aeruginosa PAO1. The transformants showed higher MIC values for all β-lactams except for cefepime, which was conferred by carrying blaVIM-2 encoded on the IncW plasmid (Table 1). The IncW plasmid has high affinity for various bacterial species, and thereby has great potential for broad spread [9]. NR1374 was determined to belong to sequence type ST22 using the genomic sequences of seven housekeeping genes (arcA, aspC, clpX, dnaG, fadD, lysP and mdh) [10].