China
Africa
Explore chapters and articles related to this topic
Out of Nowhere
Published in Rae-Ellen W. Kavey, Allison B. Kavey, Viral Pandemics, 2020
Rae-Ellen W. Kavey, Allison B. Kavey
Accurate diagnosis of Ebola virus infection is a critical part of an effective outbreak response, but establishing safe, rapid diagnostic testing in resource-poor environments has been challenging. Ultimately, RT-PCR testing has become the standard for Ebola virus diagnosis. With RT-PCR, RNA molecules are converted into their complementary DNA sequences (cDNA) using reverse transcriptase enzymes, followed by amplification of the newly synthesized cDNA by standard PCR procedures. There are several standard, real-time RT-PCR tests approved for emergency use by the WHO and FDA, and four of these are commercially available as kits. Real-time RT-PCR diagnosis in an outbreak setting still requires field labs with substantial infrastructure and staff with expertise in molecular techniques.129
Nucleic Acids
Published in Danilo D. Lasic, LIPOSOMES in GENE DELIVERY, 2019
In gene therapy, the major interest is in DNA and cDNA (complementary DNA which is sequences of DNA that encode particular proteins). Therefore, we shall briefly introduce DNA, from its biological, chemical, and physical viewpoint which will enable us to appreciate the complexity of genosomes as well as the thermodynamics and kinetics of DNA interactions with liposomes.
Cellular and Molecular Basis of Human Biology
Published in Lawrence S. Chan, William C. Tang, Engineering-Medicine, 2019
RNA PCR. To examine mRNA, which is unstable and vulnerable to RNase degradation, investigators would need to first convert mRNA to a stable DNA form, called complementary DNA, or cDNA. This step is achieved by a reverse transcriptase, which reverse the DNA to mRNA process of transcription. The reverse transcription technology was built upon the knowledge that retrovirus, a type of RNA virus, has the ability to reverse this DNA to mRNA process by reversely transcribing mRNA to cDNA for their replication process. After the cDNA is generated, the PCR process will basically follow the DNA PCR method as described above. This RNA PCR is commonly designated as RT-PCR (or reverse transcription-PCR).
Attenuation of streptozotocin induced high fat diet exacerbated dyslipidemia mediated hepatic and aortic injuries in male pigs by camel milk
Published in Egyptian Journal of Basic and Applied Sciences, 2023
Hadiza Bello Rilwan, Sunday Samuel Adebisi, James Abrak Timbuak, Sunday Blessing Oladele, Aliyu Muhammad, Wusa Makena, Adamu Abubakar Sadeeq
The expression levels of the LOX-1 gene in the aorta of the different experimental groups were compared using a relative quantification assay of LOX-1 mRNA performed by real-time PCR (Gene Bank ID: NM_213805.1). According to the manufacturer’s instructions, the RiboPure Extraction kit was used to extract total RNA from pig aorta tissues. A high-capacity cDNA reverse transcription kit with an RNAase inhibitor was used to make complementary DNA (cDNA) (Applied Biosystems, USA). TaqMan labeled primers and probes were used for the target genes in gene expression assays. Forward primer sequence (5’ to 3’) used for LOX-1 was TCGGAGTGAACGGATTTGGC and reverse primer sequence TGACAAGCTTCCCGTTCTCC. As an endogenous control, GAPDH as the housekeeping gene (Gene Bank ID: NM_213805.1) was used, the forward primer sequence (5’ to 3’) used for GAPDH was AGTCTTTCCACTCTGCGGTG and reverse primer sequence GGTCACCAGTAATCCCAGGC. All primers and probes were obtained from Applied Biosystems in the United States. The target mRNA was quantified by comparing the total RNA added to each reaction and normalizing it with endogenous control as an active reference. The following cycling conditions were used for PCR reactions: 1 cycle at 50°C for 2 minutes, 1 cycle at 95°C for 10 minutes, 40 cycles at 95°C for 15 seconds and 60°C for 1 minute. Relative real-time PCR was used for relative quantification. The real-time PCR technique estimates gene expression levels simultaneously during real-time PCR amplification and at the end of the experiment.
Toxicological analysis of synthetic dye orange red on expression of NFκB-mediated inflammatory markers in Wistar rats
Published in Drug and Chemical Toxicology, 2022
Ishfaq Shafi Khan, Shafat Ali, Khalid Bashir Dar, Mohd Murtaza, Md. Niamat Ali, Showkat Ahmad Ganie, Showkat Ahmad Dar
In order to investigate the expression pattern of several inflammatory marker genes, we isolated total RNA using the standard TRIZOL method. Briefly, tissue was chopped in 1 ml ice cold Trizol followed by centrifugation at 13,500 rpm for 15 min at 4 °C. Supernatant was collected in a fresh Eppendorf tube and the pellet discarded. 300 μl of ice cold chloroform was applied to supernatant and then centrifuged for 15 min at 13,500 rpm preceded by vortexing for 15 s. Three distinct phases were observed in the Eppendorf tube. The upper phase was carefully transferred to a new Eppendorf tube and 500 μl ice cold isopropanol was added. The contents were briefly subjected to vortex and subsequent centrifugation at 13,500 rpm for 15 min at 4 °C to get the pellet. The supernatant was removed followed by cleaning of pellet three times and then centrifuged in chilled ethanol (75%) for 10 min at 10,000 rpm. RNA concentration was checked using nanodrop. cDNA synthesis kit was used to convert 1 μg RNA to complementary DNA for expression analysis during real-time PCR. The relative fold changes in the gene expression of COX-2, iNOS, and NFκB/p65 was calculated by the comparative 2−ΔΔCt method (Livak and Schmittgen 2001). The primer sequences and the thermal profile used for RT-PCR assay are presented in Tables 1 and 2.
Circ-MKLN1/miR-377-3p/CTGF Axis Regulates the TGF-β2-induced Posterior Capsular Opacification in SRA01/04 Cells
Published in Current Eye Research, 2022
Jiajia Liu, Yiran Dong, Qingshan Ji, Yuechun Wen, Genjie Ke, Lei Shi, Wei Guan, Weiping Xu
Total RNA extraction was performed by TRI Reagent® (Sigma-Aldrich). Reverse transcription assay by High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) was used to synthesize the complementary DNA (cDNA), and the expression level was quantified using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems). All primers were provided by Sangon: circ-MKLN1 (sense, 5ʹ-GGCACCAAGAAAGACTCTGG-3ʹ; antisense, 5ʹ-CAGGCCTTTCGAGCTTTAGA-3ʹ); MKLN1 (sense, 5ʹ-AACCTGATCCTCCGGTAGC-3ʹ; antisense, 5ʹ-ATATGGAACTCATCTGCCCCG-3ʹ), miR-377-3p (sense, 5ʹ-TCGGCAGGATCACACAAAGGCA-3ʹ; antisense, 5ʹ-CTCAACTGGTGTCGTGGA-3ʹ); CTGF (sense, 5ʹ-CACCCGGGTTACCAATGACA-3ʹ; antisense, 5ʹ-TCCGGGACAGTTGTAATGGC-3ʹ); GAPDH (sense, 5ʹ-TCACCAGGGCTGCTTTTAAC-3ʹ; antisense, 5ʹ-GACAAGCTTCCCGTTCTCAG-3ʹ); U6 (sense, 5ʹ-GCTTCGGCAGCACATATACTAAAAT-3ʹ; antisense, 5ʹ-CGCTTCACGAATTTGCGTGTCAT-3ʹ). The expression analysis was conducted using 2−∆∆Ct method by normalizing Ct values to GAPDH or U6 Ct value.21