China
Africa
Explore chapters and articles related to this topic
Molecular Advances in Bioremediation of Hexavalent Chromium from Soil and Wastewater
Published in Maulin P. Shah, Removal of Refractory Pollutants from Wastewater Treatment Plants, 2021
Aditi Nag, Devendra Sharma, Sudipti Arora
Our group obtained six isolates which were able to tolerate and survive on a 0.2% Cr concentration. These isolates were further categorized into three categories as the isolates giving an optimal reduction of Cr on less (0.1% Cr) to more (0.25% Cr) concentrated exposures than the initial concentration of Cr in the growth medium. Genomic DNA was isolated from the isolates of each category and the variable region of 16s rDNA was amplified using two universal primers (see Figure 7.1a). Universal primers are those which are designed against the conserved sequences and therefore are likely to amplify sequences even from the yet unidentified and unsequenced genomes. An alternate method is to prepare a molecular profile of rapidly amplified polymorphic DNA (RAPD), which is a technique in which random primers are used to amplify DNA fragments in unknown isolates. This random amplification gives very specific bands for a particular species as well as various strains of microorganisms. Thus, unique molecular profiles can be created to specifically identify any microorganism even to their strains (see Figure 7.1b).
Approaches to the Measurement of Biological Pollutants
Published in Somenath Mitra, Pradyot Patnaik, Barbara B. Kebbekus, Environmental Chemical Analysis, 2018
Somenath Mitra, Pradyot Patnaik, Barbara B. Kebbekus
PCR is a technique for the amplification of a few strands of DNA by several orders of magnitude by generating thousands to millions of copies of a particular DNA sequence. The method relies on thermal cycling, where the repeated heating and cooling are used to denature the DNA unwinding the double-stranded macromolecules into single strands. Enzymes then cause the replication of the DNA. Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA polymerase (an enzyme that catalyzes the polymerization of deoxyribonucleotides into a DNA strand) are key ingredients that make the selective and repeated amplification feasible. As PCR progresses, the DNA generated is itself used as a template for replication, setting in motion a chain reaction in which the DNA template is amplified exponentially.
Multiplex Testing of Bcr-Abl1 and Jak2 V617f in Suspected Mpn Using Rt-Pcr Rdb Method
Published in Cut Adeya Adella, Stem Cell Oncology, 2018
N. Masykura, F. Albertha, A.R.H. Utomo, U. Habibah, M. Yunus, Suharsono, F. Selasih, A. Bowolaksono
Oligonucleotide probes were designed to bind four BCR-ABL1 transcript variants and JAK2 V617F mutation. The hybridisation process (RDB) was developed based on the previous report with several modifications such as finding optimal hybridisation temperatures (Zhang et al., 1991). Briefly, biotinylated PCR primers were used to amplify the cDNA template generated by reverse transcription of total RNA in blood samples. Biotinylated PCR products were then hybridised and retained on a nylon membrane containing oligonucleotide probes recognising four variants of BCR-ABL1 and mutated JAK2 V617F alleles. Oligonucleotide probes were spotted and organised as shown in Figure 1A. Naked eye visualisation of specific hybridisation was achieved as the result of the colorimetric development of streptavidin conjugated alkaline phosphatase binding to retained biotinylated PCR products.
Synthesis of itaconic acid from agricultural waste using novel Aspergillus niveus
Published in Preparative Biochemistry and Biotechnology, 2018
Ramakrishnan Gnanasekaran, Balaji Dhandapani, Kannappan Panchamoorthy Gopinath, Jeyaraj Iyyappan
The identification of isolated fungal species was carried out by 18S rRNA sequencing. Genomic DNA was extracted from fungal according to the method described by Zhou et al. (2008).[10] DNA concentrations were measured by running aliquots on 1% agarose gel. Universal primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used for amplification of respective coding sequence. The reaction mixture (25 μL) of PCR cycle contained 1.5 μL of ITS1, 1.5 μL of ITS4, 5 μL of DNAse–RNase free water, and 12 μL of Taq Master Mix. The PCR amplification produces multiple copies of the target DNA sequence. The resulting product is used as the template for the sequencing. The amplification process was carried out at the temperature of 94 °C for ∼3 min (initial denaturation). Then, the process was continued nearly 30 cycles at the temperature of 94 °C for ∼30 s. Further, the annealing and extension step was performed at 60 °C for 30 s and 72 °C for 1 min, respectively. The final extension step was carried out at 72 °C for 10 min. DNA sequencing was done by the common Sanger sequencing method. The two strands of the DNA (3′–5′ and 5′–3′) are sequenced separately using the forward and reverse primers. After the sequencing process completion, the phylogenic tree was generated and the sequence was compared with others. The phylogenic tree was generated by using the bioinformatics tool. It is used to visualize the result of hierarchical clustering calculation.
Development of a new multiplex PCR to detect prevalent species of house dust mites in house dust
Published in International Journal of Environmental Health Research, 2021
Ana Sofia Oliveira, Carlos Gaspar, Joana Rolo, Cristiana Costa Pereira, Rita Palmeira-de-Oliveira, João Paulo Teixeira, José Martinez-de-Oliveira, Ana Palmeira-de-Oliveira
Primers were designed with NCBI/Primer-BLAST using the following parameters: the minimum and maximum melting temperatures (Tm) permitted for primers were 55°C and 60°C, respectively. The maximum of CG content permitted by each primer was 60%. The optimal length for each primer was 20 bases (18 bases minimum and 25 bases maximum) and the amplified region length permitted ranged from 100 to 1000 bps. Among the primer candidates that were retrieved from Primer-Blast and further analysed with Oligo Analyser software 1.0.2, a selection was made based on similar melting temperatures and absence of cross reactivity between primers. The selected primers were synthesized by Stabvida (Caparica, Portugal).