China
Africa
Explore chapters and articles related to this topic
Beyond the Molecular Frontier: Challenges for Chemistry and Chemical Engineering
Published in Moayad N. Khalaf, Michael Olegovich Smirnov, Porteen Kannan, A. K. Haghi, Environmental Technology and Engineering Techniques, 2020
Aidé Sáenz-Galindo, Adali O. Castañeda-Facio, José J. Cedillo-Portillo, Karina G. Espinoza-Cavazos
In 2017, Finetti reported the study of novel gel for DNA electrophoresis using a classic “click chemistry” reaction whit copper (I)-catalyzed azide– alkyne cycloaddition (CuAAC), to cross-link functional polymer chains, found that this type of novel materials gel for DNA electrophoresis is useful, present, important and resulted in time and reagent consumption. The analysis gave results that the used classic reaction cop-per (I)-catalyzed azide–alkyne cycloaddition (CuAAC) reaction. This type of the reaction did not require UV initiator and it decreases the toxicity of monomers; found excellent resulted in separations of DNA. Conclude that is a good alternative green for separation of the DNA, used whit matrix of gel organic by “click chemistry.”18
Heat and mass transfer in silicon-based nanostructures
Published in Klaus D. Sattler, Silicon Nanomaterials Sourcebook, 2017
Solid surfaces with a rough morphological texture can be considered as porous surfaces that can absorb liquids. Imbibition occurs on the formed solid–liquid interfaces. This morphologically induced dispersion of the liquid is called hemi-wicking (Figure 11.15) (Bico et al., 2002; Quéré 2008). The capillary-driven hemi-wicking flow of the liquid has potential applications in biological and industrial processes, which include biomedical devices for chromatography, DNA electrophoresis and drug delivery, oil recovery, sensors, and thermal management in phase-changing boiling heat transfer schemes. Besides the static wetting characteristics on an interface, the dynamic factor of hemi-wicking has an effect on the boiling heat transfer, due to the concurrent liquid refreshment toward the surface and vaporization of the liquid.
Movement from electricity
Published in Michael Pycraft Hughes, Nanoelectromechanics in Engineering and Biology, 2018
Although electrophoresis is an important force for the manipulation of nanoscale particles such as proteins and DNA, it has somewhat less promise for the precise manipulation of particles on this scale; it operates best on larger scales such as the now-famous stripes of DNA electrophoresis gels commonly used in medicine and forensic science for the determination of identity. For our study here, we require forces that are capable of manipulating submicrometer particles on at least a scale of the order of a few micrometers. In order to achieve this, another class of electrokinetic methods can be introduced.
Implications of peroxisome proliferator-activated receptor gamma (PPARY) with the intersection of organophosphate flame retardants and diet-induced obesity in adult mice
Published in Journal of Toxicology and Environmental Health, Part A, 2022
Gwyndolin M. Vail, Sabrina N. Walley, Ali Yasrebi, Angela Maeng, Thomas J. Degroat, Kristie M. Conde, Troy A. Roepke
Initial genotyping used DNA samples from ear clippings taken at weaning, and after experimental completion, ear samples were again taken post-euthanasia to confirm the animal was the correct genotype. Genotyping for PPARγKO mice required testing for the presence of both Syn1-cre and the absence of Pparg. To this end, primers were used according to established protocols from Jackson Laboratory (Syn1-Cre+: XXXF: CTCAGCGCTGCCTCAGTCT, XXXR: GCATCGACCGGTAATGCA; and Syn1-Cre-: XXXF: CTAGGCCACAGAATTGAAAGATCT, XXXR: GTAGGTGGAAATTCTAGCATCATCC) to detect for heterozygosity of the Syn1-cre gene. Primers (XXXF: TGGCTTCCAGTGCATAAGTT, XXXR: TGTAATGGAAGGGCAAAAGG) were then utilized to detect homozygous absence of Pparg. Ear-clip DNA was extracted and Syn1-cre was amplified in RedTaq mix (Sigma) with 9 cycles of 94°C for 20 s, 65°C for 15 s, 68°C for 10 s, followed by another 9 cycles of 94°C for 15 s, 60°C for 15 s, 72°C for 10 s, 68°C for 10 s, and lastly 27 cycles of 94°C for 15 s, 60°C for 15 s, 72°C for 10 s. Pparg DNA was amplified with the same temperature protocol, but repeated the first two cycles 15 times, and repeated the last cycle 44 times. Amplified DNA was then loaded into wells of 3% agarose gel in 1x TBE buffer for DNA electrophoresis separation and genotype identification.
Enhanced degradation of phenol in floating treatment wetlands by plant-bacterial synergism
Published in International Journal of Phytoremediation, 2018
Hamna Saleem, Khadeeja Rehman, Muhammad Arslan, Muhammad Afzal
At the end of the experiment, population of total and inoculated bacteria was determined in water, on rhizoplane, and root and shoot interior of T. domingensis. Briefly, 100 µl of treated water and slurry suspension (serial dilutions up to 10−6) of plant material (after surface sterilization) were plated onto the M9 plates containing phenol as a sole carbon source and subsequently placed at 37 °C for incubation. The colony forming units (CFU) were counted after 48 h. A statistically significant number of colonies were picked and subjected to restriction fragment length polymorphism (RFLP) analysis. RFLP reaction was placed at 37 °C for 3 h, where each 1X reaction constituted 7 µL polymerase chain reaction (PCR) product, 1 µL HindIII enzyme, 1.5 µL R-buffer, and 5.5 µL deionized water, to make a total of 15 µL reaction. Restriction fragment length polymorphism (RFLP) product was confirmed by deoxyribonucleic acid (DNA) electrophoresis on 2% agarose gel.
Toxicological aspects of Campomanesia xanthocarpa Berg. associated with its phytochemical profile
Published in Journal of Toxicology and Environmental Health, Part A, 2019
Joubert Aires De Sousa, Lismare da Silva Prado, Bárbara Lopes Alderete, Fernanda Brião Menezes Boaretto, Mariangela C. Allgayer, Fabiano Moraes Miguel, Jayne Torres De Sousa, Norma Possa Marroni, Maria Luísa Brodt Lemes, Dione Silva Corrêa, Alexandre de Barros Falcão Ferraz, Jaqueline Nascimento Picada
The comet assay was carried out according to Tice et al. (2000) with minor modifications (de Sousa et al. 2017). Blood samples (50 µl) were transferred to heparin solution (Liquemine® 25000 UI, 10 µl) and samples of liver, kidney, and brain transferred to PBS. Cell suspensions (5 µl) were embedded in 95 µl low melting point agarose 0.75% (GibcoBRL) and spread onto agarose-precoated microscope slides. After solidification, slides were treated with either PBS (without H2O2) or freshly prepared H2O2 0.25 mM (ex vivo treatment with H2O2 for 5 min at 4ºC, in blood samples collected 3 and 24 hr after the last administration) (Da Costa E Silva et al. 2014). Slides were washed 3 times with PBS and then placed in lysis buffer (NaCl 2.5 M, EDTA 100 mM, and Tris 10 mM, freshly added Triton X-100 1% (Sigma), and DMSO 10%, pH 10) for 48 hr at 4ºC. After this, the slides were incubated in freshly prepared alkaline buffer (NaOH 300 mM and MEDTA 1 M, pH > 13) for 20 min at 4°C in an electrophoresis cube. An electric current of 300 mA at 25 V (0.90 V/cm) was applied for 15 min to induce DNA electrophoresis. The slides were then neutralized (Tris 0.4 M, pH 7.5), stained with silver, and examined under a microscope. Images of 100 randomly selected nucleoids (50 nucleoids from each slide) from each animal were analyzed. Nucleoids were also visually scored according to tail size into 5 classes, ranging from undamaged (0) to maximally damaged (4), resulting in a single DNA damage score for each animal, and consequently, for each group studied. Therefore, the damage index (DI) ranged from 0 (completely undamaged, 100 cells × 0) to 400 (with maximum damage, 100 × 4). Damage frequency (DF) was calculated based upon the number of nucleoids with tail versus those with no tail.