China 
Africa 
Explore chapters and articles related to this topic
Psychophysical Measurement of Human Oral Experience
Published in Alan R. Hirsch, Nutrition and Sensation, 2023
Derek J. Snyder, Linda M. Bartoshuk
Although PTC/PROP bitterness has figured prominently in descriptions of oral sensory variation, it is important to remember that it is a single, highly robust example of the sensory variation that occurs for virtually all oral stimuli. The common theme is that individual differences in sensation for any oral stimulus probably result from genetic variation in a specific receptor or transduction element, which is then amplified by differences in fungiform papilla density. Recent identification of sequence polymorphisms associated with variation in sweet, umami, and fat perception supports this view (Fushan, Simons, Slack, and Drayna 2010; Keller et al. 2012; Raliou et al. 2009; Shigemura, Shirosaki, Sanematsu, Yoshida, and Ninomiya 2009), as does an emerging interaction between PROP bitterness, T2R38 genetics, and sequence variation in the taste bud trophic factor gustin (Calò et al. 2011). As new oral sensory gene variants and expression patterns are found, it is likely that taster status will be defined more broadly, based on genotype-phenotype relationships across multiple aspects of oral sensation and anatomy.
Foundation year trainees
Published in David McGowan, Helen Sims, Making the Most of Your Medical Career, 2021
Many specialties want you to demonstrate that you have not simply decided on that career on a whim but rather, you have considered this choice carefully and have suitable experience with which to base your decision. A great way to do this is to undertake a taster day or week within a specialty you are seriously considering. When you organise this, try to make sure you personally meet the lead of core training for the specialty. He or she may even be at your interview! Other ways of showing commitment to a specialty include: attending the career open dayreading the specialty-equivalent monthly journal - remember one or two articles you have read so you can discuss them if askedattending royal college events - look on their website, they will have a calendar full!keeping a logbook: surgery, anaesthetics, and accident and emergency.
Medicine making sense
Published in Alan Bleakley, Educating Doctors’ Senses Through the Medical Humanities, 2020
An environmental pattern prepares or educates the senses. This can be readily illustrated in wine appreciation (Brochet and Dubourdieu 2001). A naïve taster simply tastes the wine and may or may not be able to pick out differing smells, textures and tastes. If the taster is prepared however – for example, told that a Californian Viognier is a mix of dry peach with smoky pear and lemon – on drinking, the wine differentiation is easier. In building connoisseurship in medicine, the doctor develops a storehouse of tacit referents as patterns of metaphors, images and narratives, repeated in the linguistic register as aphorisms or maxims (Levine and Bleakley 2012). As an organised tacit knowledge, this again can be called a ‘poetic imagination’ (Bachelard 1986). Thus, where William Osler says that you must listen to the patient’s story because here is the diagnosis, this must be extended to include a pattern of sensory effects. Across pedagogy, such ‘advance organisers’ allow for bridging or scaffolding between the known and the unknown.
Novel homozygous mutation of plasminogen in ligneous conjunctivitis: a case report and literature review
Published in Ophthalmic Genetics, 2021
Liyan Xu, Yajie Sun, Kaili Yang, Dongqing Zhao, Yiqiang Wang, Shengwei Ren
To identify the mutation site associated with the disease, we sequenced the complete 19 coding exons and exon-intron boundaries of the PLG gene by Sanger sequencing. The primers were designed using Primer Premier 5, and the primer sequences were shown in Supplemental Table S1. After co-segregation analysis, we found that the patient was homozygous for a missense mutation in exon 7, resulting in an amino acid change from glutamic acid to lysine (c.763 G > A, p.Glu255Lys). Both her parents were heterozygous for the locus (Figure 3). The missense mutation was further analyzed by Sorting Intolerant from Tolerant (SIFT), Polymorphism Phenotyping v2 (Polyphen-2) and Mutation Taster to predict the potential effect on protein function. In silico analysis of c.763 G > A (p.Glu255Lys) in PLG predicted an effect on protein function with a SIFT score of 0.01. Pathogenicity analysis of the mutation indicated that it was “probably damaging” with a score of 0.984 (sensitivity: 0.55; specificity: 0.94) by PolyPhen-2. The mutation was predicted to be disease-causing by Mutation Taster. Furthermore, structural analysis of the mutation was processed using the crystal structure of proteins in Swiss-Pdb Viewer 4.1.0 (Swiss Institute of Bioinformatics, Lausanne, Switzerland). The results showed the influence of the mutation on the spatial structure of the protein side chains (Figure 4).
Novel compound heterozygous PANK2 gene mutations in a Chinese patient with atypical pantothenate kinase-associated neurodegeneration
Published in International Journal of Neuroscience, 2018
Yuan Cheng, Yu-tao Liu, Zhi-hua Yang, Jing Yang, Chang-he Shi, Yu-ming Xu
Analysis of the PANK2 gene showed two compound heterozygous mutations: c.A260 > G (p.D87G), and c.405dupC (p.H136PfsX45) (Figure 3). The mother (I-1, age 49 years) was heterozygous for the p.H136PfsX45 mutation, and the father (I-2, age 50 years) was heterozygous for the p.D87G mutation. The sister (II-1, age 28 years) carried none of the mutations. The mutation c.405dupC was absent in the 1000 Genomes Project database (http://www.1000genomes.org/), The Exome Aggregation Consortium (ExAc; http://exac.broadinstitute.org/), and in all 200 control individuals. Multiple sequence alignment of the related sequence region containing c. 260A > G and c.405dupC showed that amino acid residues were highly conserved across various species; therefore, any non-synonymous change at this position might be deleterious for normal functioning of the protein (Figure 4). The analysis of Mutation Taster shows similar results. The prediction of c.260A > G showed it is just a polymorphism with reference ID rs562740927, while the prediction of c.405dupC indicated it is a disease-causing site.
A de novo c.113 T > C: p.L38R mutation of SPTLC1: case report of a girl with sporadic juvenile amyotrophic lateral sclerosis
Published in Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration, 2022
Xiaoxuan Liu, Ji He, Weiyi Yu, Dongsheng Fan
DNA was isolated from peripheral blood using a DNA Isolation Kit (Bioteke, AU1802). After C9ORF72, SMN and PMP22 genes were initially excluded, whole-exome sequencing (WES) was performed in accordance with the manufacturer’s protocol. The amplified DNA sample was captured in the Agilent Human ALL Exon V6 Kit (Agilent Technologies, Inc., USA), 98% coverage was obtained. Quantified DNA was sequenced with 200-bp paired-end reads on Illumina HiSeq2500 platform (Illumina, Inc., USA). Samtools and Picard while variant calls were obtained using GATK. Mutations of the major ALS genes (C9ORF72, SOD1, TARDBP, FUS, SETX and ALS2) were excluded during WES analysis. A heterozygous mutation c.113 T > C, p. Leu38Arg of SPTLC1 was detected in the patient and was absent in the unaffected parents. This variant was validated by Sanger sequencing (Figure 1(D)) using an ABI 3730XL DNA analyzer (Applied Biosystems, Waltham, MA, USA) with the primers designed by Primer Premier 5.0 (Forward: TCCTAGCAAAGTATCCAAGACCA, Reverse: GAGGGAGAAATTGCCTGCTA). The mutation c.113 T > C of SPTLC1 was not present in the database dbSNP, 1,000 genomes, and GnomAD, nor in the 650 Chinese healthy controls. It was predicted to be damaging, probably damaging in SIFT, PolyPhen, and disease-causing in Mutation Taster. The novel mutation was also segregated with the phenotype and was classified to be pathogenic according to American College of Medical Genetics (ACMG) standards (2015) (8) (PS2 + PM1 + PM2 + PP2 + PP3). Written informed consent was obtained from the patients for the publication of this report and any accompanying images.