China
Africa
Explore chapters and articles related to this topic
Gene Structure and Expression in Colon Cancer
Published in Leonard H. Augenlicht, Cell and Molecular Biology of Colon Cancer, 2019
One of the most interesting observatins is that in several myelomas, an IAP LTR has been shown to rearrange into the vicinity of the mos gene, causing transcriptional activation of this usually silent proto-onc sequence.101-104 Coupled with the aforementioned Gl specificity of IAP expression, it may be suggested that a similar Gl elevation in transcription is imposed on the mos gene.100 This is of particular significance since mos has homology to a yeast gene which is necessary for the transit of yeast cells through Gl.105 Sequence characteristics of a cloned cDNA from the colon tumor raised the possibility that the non-coding strand was transcribed in the tumor, perhaps suggesting an enhancer or promotor function of a rearranged IAP element in the colon tumor as well.98 The IAP LTR was found to contain a region related to other enhancer elements,98 and the LTR can indeed function as a promotor.106 Rearrangements of IAP sequences into rRNA genes with consequent inactivation of the locus has also been reported.107
Cellular and Molecular Basis of Human Biology
Published in Lawrence S. Chan, William C. Tang, Engineering-Medicine, 2019
Transcription. This process can be viewed as three steps: initiation, elongation, and termination (Hillis et al. 2014). Initiation: RNA polymerase binds to the promoter of DNA, initiating the unwinding of the double-strand.Elongation: The bound RNA polymerase acts as a primer, to initiate the transcription on the template strand of DNA, which is complementary to the coding strand of DNA. RNA polymerase adds ribonucleoside triphosphates (ATP, UTP, CTP, GTP) to build the RNA strand along the template DNA from 3’ to 5’ of template direction).Termination: When RNA polymerase reaches the terminating site on the DNA template, the newly synthesized RNA is released. This RNA strand thus have same base sequence as the coding strand DNA, except TTP is replaced by UTP in the RNA.
Regulation of Cell Functions
Published in Enrique Pimentel, Handbook of Growth Factors, 2017
Heat shock proteins (HSPs) are defined as proteins that can be induced by temperature elevation and other stimuli in a variety of organisms, from bacteria to man.396-402 HSPs may be necessary for the survival and proliferation of cells under stress conditions and probably also under nonstress conditions. The genes coding for HSPs contain a conserved sequence of 14 bp, the Pelham box, which is located on the coding strand of DNA upstream of the TATA box and serves as the promoter for HSP mRNA transcription. The presence of three inverted repeats of a five-base module, nGAAn, located about 80 to 150 bp upstream of the transcription start site is characteristic of HSP genes. This conserved sequence, termed heat-shock element (HSE), is the site of interaction with a transcriptional activator, the heat-shock factor (HSF). The HSF appears in the nucleus as an inactive oligomer that is converted on heat shock to a multimer. In insect polytenic chromosomes, the HSF oligomer transition is accompanied by a relocalization of the factor from a general chromosomal distribution to specific heat-shock puff sites.403 Other DNA regulatory signals may contribute to the activation of HSP gene expression. This expression can be induced by a wide diversity of environmental agents in addition to heat shock, including chemical and physical agents, as well as microbial infections and genetic lesions. The HSPs are involved in the processes of cell proliferation induced by hormones, growth factors, and other mitogens under nonstress conditions. Embryonic development and cellular differentiation are also associated with altered expression of HSP gene expression.
Challenges and promise at the interface of metaproteomics and genomics: an overview of recent progress in metaproteogenomic data analysis
Published in Expert Review of Proteomics, 2019
Henning Schiebenhoefer, Tim Van Den Bossche, Stephan Fuchs, Bernhard Y. Renard, Thilo Muth, Lennart Martens
Third, if protein reference databases provide insufficient species information, genomic or transcriptomic sequencing data can be used to create search databases for protein identification. This allows sample-specific sequence databases to be created that contain only data from the organisms in the sample. A benefit of genomic data is that genomes are present as one to two copies per cell in most microbial organisms, no matter whether this cell is metabolically active or not. Thus, dormant organisms are also implicitly covered. Nevertheless, metagenomics often does not fully cover all organisms in a sample [32]. In this context, it is worth noting that metagenomic approaches in general require a high read coverage to identify low abundant organisms and that such an approach may therefore come with high costs [55]. With transcriptomic data, only actively transcribed DNA-regions are covered, while also delivering knowledge about the coding strand. Coverage can be increased by combining sequencing data from replicates or from similar samples, and even combinations of multiple samples can be used for this purpose [33].
Envisioning the development of a CRISPR-Cas mediated base editing strategy for a patient with a novel pathogenic CRB1 single nucleotide variant
Published in Ophthalmic Genetics, 2022
J.-S. Bellingrath, M. E. McClements, M. Shanks, P. Clouston, M. D. Fischer, R. E. MacLaren
Although the patient’s novel nonsense mutation, c.2885T>A (p.Leu962Ter) is not amenable to correction with a currently available base editor, the premature termination stop codon (PTC) could be converted to a translatable codon by a base editor, thus allowing the production of a full-length protein. To this end, Lee et al. developed “CRIPSR-pass”, an ABE7.10 fused to the evolved SpCas9 variant xCas3.7 (54). By targeting the coding strand, the patient’s PTC TAA would be converted to a TGG codon, which would be read as Tryptophan (Trp, W) by the cell’s translational machinery. Alternatively, by targeting the first base of the codon on the non-coding strand (ATT>GTT), the novel nonsense mutation would be converted to Glutamine (Gln,Q) (Figure 3). The evaluation of the functional effect of these induced missense changes is critical to assess therapeutic success. Both missense changes are predicted to be “possibly damaging” by Polyphen2, with a pathogenicity score of 0.99 (sensitivity = 0.68, specificity = 0.97) for Trp and a pathogenicity score of 0.98 (sensitivity 0.78, specificity 0.96) for Gln. While Leu is not strongly preserved across species, the closely related, aliphatic, nonpolar and hydrophobic isoleucine and valine—not Trp or Gln—are used in place of Leu at the equivalent position. Neither Gln nor Trp bear a strong structural resemblance to Leu. While the molecular weight (MW) of the amide Gln is 146 g/mol and similar to that of Leu’s (130 g/mol), Gln is polar and hydrophilic while Leu is nonpolar and hydrophobic. Trp shares its hydrophobicity with Leu but has a higher MW (204 g/mol) and differs from Leu’s structure due to an aromatic amino acid side chain. Trp and Gln in place of Leu at position 962 are absent from the variant database gnomAD. When assessing possible bystander editing, targeting the non-coding strand would be preferable, since additional As are absent in the editing window, whereas targeting the coding sequence could result in bystander editing due to the presence of an additional A in the base editing window: AATATAATTCAGAAGCAATG (editing window underlined, bystander editing in blue, mutation in red) (Figure 3) (55). In summary, while editing the non-coding strand is preferable due to a lower risk of accruing bystander edits, both missense changes would result in possibly damaging variants. Prime editing (PE), a more recently described form of genome editing, is unique in its capability of editing all 12 transversion and transition variants as well as small indels and could therefore also edit this patient’s novel pathogenic transversion variant. PE uses a catalytically impaired Cas9 fused to a reverse transcriptase (RT) and a prime editing gRNA (pegRNA) that both specifies the target site and encodes the desired edit (56). Although PE has yet to be tested in a human clinical trial, it bears huge potential for editing pathogenic variants not targetable with traditional base editors.