China
Africa
Explore chapters and articles related to this topic
HLA-DR and -DQ Typing by DNA-RFLP Analysis
Published in M. Kam, Jeffrey L. Bidwell, Handbook of HLA TYPING TECHNIQUES, 2020
The restriction enzyme TaqI is favored by many investigators because it permits distinction between the majority of DRB-DQB-DQA haplotypes.5-9 An underlying reason for this is related to the recognition sequence within DNA of TaqI (5′-TCGA-3′) which contains the nucleotide dimer CpG. Restriction sites containing CpG dimers show a higher frequency of polymorphism in human DNA than other restriction sites, a probable result of CpG to TpG transition mutation within the dimer sequence. Hence, high level mutation at these sites is detectable by TaqI RFLP typing.3
Genetics
Published in Rachel U Sidwell, Mike A Thomson, Concise Paediatrics, 2020
Rachel U Sidwell, Mike A Thomson
These are varying Length fragments of DNA that are used to detect DNA polymorphisms in individuals. Bacterial enzymes known as restriction enzymes, e.g. EcoRl, cut the DNA at recognized sequences known as restriction sites. If a polymorphism or mutation exists within the DNA sequence cut by the restriction enzyme, the DNA will not be cut at this point and the DNA Length will vary from the expected Length and may be detected by gel electrophoresis. Once a variation is detected, DNA sequencing of the DNA region will determine the precise gene change.
Methylome and epigenetic markers
Published in Moshe Hod, Vincenzo Berghella, Mary E. D'Alton, Gian Carlo Di Renzo, Eduard Gratacós, Vassilios Fanos, New Technologies and Perinatal Medicine, 2019
Skevi Kyriakou, Marios Ioannides, George Koumbaris, Philippos Patsalis
Currently there are three main approaches for the detection and analysis of methylation patterns across the genome. First, utilizing methylation-sensitive restriction digestion enzymes, the enzyme's restriction site is used for enrichment of specific methylated regions. This approach has two main drawbacks: it is limited to the regions containing the restriction sites, and it is highly susceptible to false positive results due to incomplete digestion of the DNA (9). The second approach, sodium-bisulfite–based treatment, involves the conversion of unmethylated cytosines to uracils leaving the methylated cytosines unchanged. Bisulfite conversion is regarded as the gold standard for DNA methylation analysis since it enables mapping of methylated sites at the single base pair resolution (10). However, due to the chemical treatment of DNA, it can cause substantial degradation of DNA and incomplete conversion of unmethylated cytosines to uracils leading to false positive results (11). The third approach involves the enrichment of methylated DNA through affinity-based assays, involving the use of antibodies specific to methyl sites, namely, methylated DNA immunoprecipitation (MeDIP), or the use of methyl-binding proteins (MBD) (12,13).
Helicobacter pylori PqqE is a new virulence factor that cleaves junctional adhesion molecule A and disrupts gastric epithelial integrity
Published in Gut Microbes, 2021
Miguel S. Marques, Ana C. Costa, Hugo Osório, Marta L. Pinto, Sandra Relvas, Mário Dinis-Ribeiro, Fátima Carneiro, Marina Leite, Ceu Figueiredo
The expression vector pGEX-6P-2 (GE Healthcare) was engineered to co-express HP1012 and HP0657, each with a different tag. To the original vector backbone, a synthetic 109-nucleotide sequence containing a Tac promoter, a ribosome binding site, a sequence of six histidines, and a new SacI restriction site was added (TGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGGGCAGCAGCCATCACCATCATCACCACAGCCA, Sigma), followed by the original EagI restriction sequence. The 109 ssDNA sample was converted to dsDNA by PCR, double-digested with SacI and EagI, and introduced into pGEX-6P-2. (The new vector was named pGEX_His.) All vectors used for protein expression are listed in Supplementary Table S8. For cloning and expression, HP1012 and HP0657 genes were amplified from the genomic DNA of H. pylori 26695, and the PCR products and the plasmid were digested with EcoRI and XhoI or with SacI and EagI (New England Biolabs). All primers used for cloning and sequencing are listed in Supplementary Table S7. Ligation of the PCR products with the pGEX-His plasmid was performed following the instructions for the Quick Ligation™ Kit (New England Biolabs). E. coli strain BL21 (DE3) (NZYtech) was transformed and plated on a Luria Broth Agar medium supplemented with 100 µg/mL of ampicillin (NZYtech). Transformants were selected upon overnight incubation at 37°C. Plasmid extraction was performed using the NZYMiniprep kit (NZYtech) following the manufacturer’s instructions.
Novel mutation (R192C) in CYB5R3 gene causing NADH-cytochrome b5 reductase deficiency in eight Indian patients associated with autosomal recessive congenital methemoglobinemia type-I
Published in Hematology, 2018
Prabhakar S. Kedar, Vinod Gupta, Prashant Warang, Ashish Chiddarwar, Manisha Madkaikar
The peripheral lymphocytes of the propositus, their family members, and an unrelated normal control were washed twice with phosphate-buffered saline, and genomic DNA was extracted using QiAamp Blood Kit (Qiagen). The genomic DNA was amplified with a forward and reverse primers using previously reported protocol [10,11]. The PCR reaction volume was 20 μL, containing 2.0 μL of 10 × PCR buffer, 2.0 μL of 2 mmol/L of each dNTP, 1 μL of 10-mmol/L of each primer, and 2U of Taq polymerase (Takara). Thirty cycles of denaturation at 94°C for 20 s, annealing at 58°C for 20 s, and elongation at 72°C for 20 s were carried out, followed by an extended incubation at 72°C for 5 min. Routine screening for the most common (p.Arg50Trp, p.Gly76Ser, p.Met177Val and p.Ala179Thr) Indian mutations were carried out by respective restriction endonuclease digestion at 37°C [2]. These endonucleases are unable to detect reported common mutations in these cases; so we have done individual exon sequencing ABI PRISM 3130xl automated sequencer (Applied Biosystems, Foster City, CA) using BigDye terminator cycle sequencing chemistry. A restriction site analysis was then undertaken to identify the mutation that would permit to establish a rapid screening method to detect the novel mutation. BstUI was found to be an appropriate restriction enzyme digestion site identified for R192C mutation by NEB cutter V2.0, and BstUI restriction endonuclease digestion was subsequently performed at 60°C. BstUI recognizes a single restriction site in the wild-type sequence of exon 7 that is destroyed by the R192C.
Recent advances in screening and diagnosis of hemoglobinopathy
Published in Expert Review of Hematology, 2020
Kanjaksha Ghosh, Kinjalka Ghosh, Reepa Agrawal, Anita H. Nadkarni
RFLP-based diagnosis using proper restriction endonucleases for an amplified product can easily detect some of the common hemoglobinopathies like Hb S (Abolition of restriction site for Dde1) or Hb D Punjab (creation of new restriction site for Eco R1) BseR1 for Hb O-Arab or Eae1 for Hb Q India. Many new restriction sites can be designed for different mutations in reference laboratories and after testing their validity they can be used in downstream laboratories using this simple technique. The Technique requires a PCR machine, electrophoresis, and a gel documentation system. Simple camera can also replace the costlier Gel documentation system for the purpose.