China
Africa
Explore chapters and articles related to this topic
Genetics and exercise: an introduction
Published in Adam P. Sharples, James P. Morton, Henning Wackerhage, Molecular Exercise Physiology, 2022
Claude Bouchard, Henning Wackerhage
You will have probably heard the term epigenetics. What is it? Epigenetics means changes in gene expression that are due to chemical modifications of the DNA or of histones that are not due to variations in the DNA sequence (17). There are two main categories of epigenetic chemical reactions: the methylation of DNA and the addition of small chemical groups such as acetyl group to histones (Figure 3.11). DNA methylation refers to the addition of a CH3 (i.e. methyl) group to a cytosine (C) that is followed by a guanine (G) in the same strand. This is referred to as a CpG where the “p” stands for the phosphate that connects two bases in the same strand. In contrast, CG refers to a C in one strand pairing with a G in the other strand. Regions with many methylated cytosines are also known as CpG islands. CpG islands are present across the whole genome but are often concentrated in promoter regions of genes.
Epigenetics from Oocytes to Embryos
Published in Carlos Simón, Carmen Rubio, Handbook of Genetic Diagnostic Technologies in Reproductive Medicine, 2022
Dagnė Daškevičiūtė, Marta Sanchez-Delgado, David Monk
DNA methylation and histone modifications ultimately control chromatin accessibility and packaging, allowing for gene expression or repression. DNA methylation is the covalent modification of a methyl group to the carbon-5 atom of cytosine (5mC) residues in DNA. This reaction is catalyzed by the DNA methyltransferases (DNMTs).1,2 In the mammalian genome, 5mC mainly occurs in the context of CpG dinucleotides, forming a symmetrical pattern on both DNA strands. Non-CpG methylation is rare and restricted to exceptional cell types, including oocytes and neurones.3,4 Overall, 5mC distribution is bimodal, with the majority of the genome being heavily methylated, whereas CpG islands are usually devoid of methylation. CpG islands are discrete intervals enriched for CpG dinucleotides (200-2000 bp, GC content > 50%, observed-to-expected CpG ratio > 60%) which often overlap transcriptional start sites. Overall, 5mC is considered to be a repressive mark, especially when observed at heterochromatin, functional elements such as centromeric and pericentromeric repeats, as well as gene promoters and transposable elements. DNA methylation is essential for mammalian development being involved in lineage inappropriate gene silencing, X chromosome inactivation, imprinting, and safeguarding overall genome integrity (reviewed in 5).
The Precision Medicine Approach in Oncology
Published in David E. Thurston, Ilona Pysz, Chemistry and Pharmacology of Anticancer Drugs, 2021
CpG islands are located at the 5’-end of genes and occupy around 60% of human gene promoters. Although the majority of CpG sites in the genome are methylated in normal cells, most of the CpG islands remain un-methylated during differentiation and development, as presumably more gene expression occurs during differentiation and development but relatively less gene expression occurs in mature healthy cells. The reduction or ablation of gene expression by DNA methylation is thought to be due to a steric effect which prevents recruitment of regulatory proteins including transcription factors to the DNA. The methylation patterns in the genome are created and maintained by methyltransferase enzymes which transfer methyl groups to DNA bases or proteins such as histones. Methylated bases have also been shown to provide preferred binding sites for methyl-binding domain proteins which are known to repress gene expression through interactions with histone deacetylases (HDACs). In addition to cancer (i.e. carcinogenesis), DNA methylation has also been shown to be associated with a number of key biological processes including genomic imprinting, X-chromosome inactivation, repetitive elements repression, and aging.
BRAF testing in a South African cohort of MLH1 deficient endometrial carcinomas: lessons learnt
Published in Southern African Journal of Gynaecological Oncology, 2021
MLH1 Promoter hypermethylation analysis was undertaken using MassARRAY EpiTyper analysis, by Agena Bioscience at Inqaba Biotec. This system quantitatively assessed DNA methylation. The software package had the MLH1 promoter region target sequence (−248 to −178)14 entered, which identified primers for the best possible DNA coverage. There was a product size of 187 base pairs, which enabled evaluation of 11 CpG islands, of which 3 CpG targets could not be assessed due to lower mass cleavage products, whilst 8 CpG sites could be evaluated. The forward primers were: AGGAAGAGCGGATAGCGATTT and the reverse primers were: TCTTCGTCCCTCCCTAAAACG. The extracted patient DNA underwent bisulphite conversion, PCR, transcription and cleavage followed by mass spectrometry of the cleaved products. In each case, the percentage of methylation was determined by comparing the signal intensity between mass signals from unmethylated and methylated template DNA. The results were depicted in an Epigram.
Epigenetic changes involved in hydroquinone-induced mutations
Published in Toxin Reviews, 2021
Minjuan Zeng, Shaopeng Chen, Ke Zhang, Hairong Liang, Jie Bao, Yuting Chen, Shiheng Zhu, Wei Jiang, Hui Yang, Yixian Wei, Lihao Guo, Huanwen Tang
Rb and PTEN are critical tumor suppressor genes involved in carcinogenesis. Hypermethylation of CpG islands on promoter regions of tumor suppressor genes often predisposes them to inactivation during carcinogenic processes. Hypermethylation of the Rb and PTEN promoters decreased the mRNA expression levels by 39 and 51%, respectively, in HQ-induced malignant transformed TK6 cells (Liu et al.2017b). Moreover, Rb mRNA was significantly increased after treatment with a DNMT inhibitor. Zhang et al. (2020) also reported that HOTAIRM1 was silenced via DNA hypermethylation in cells transformed by long-term exposure to HQ as well as in workers exposed to benzene. HOTAIRM1, a myeloid-specific gene, plays an indispensable role in the development of AML. It has been suggested that HOTAIRM1, Rb, and PTEN, are potential tumor suppressors in AML.
DNA methylation abnormalities in atherosclerosis
Published in Artificial Cells, Nanomedicine, and Biotechnology, 2019
Samira Tabaei, Seyyedeh Samaneh Tabaee
DNA methylation is a process which a methyl group is added to the carbon of cytosine at 5’ position in a CpG site. Actually, methyl group is added to a cytosine-paired-with-guanine (CpG) dinucleotide sequences through DNA methylation process [21]. Furthermore, methyl group could have added to a cytosine residue which is not located adjacently to a guanine residue [22]. Most of CpG sites (more than 70%) are methylated in the genome, which are actually distributed throughout the majority of the genome including transposable elements, endogenous repeats and gene bodies. CpG islands, dense and high number of CpG sites in a short area of DNA, are mainly located at the promoter region and generally are unmethylated. The main characteristics of a CpG island are; at least 200 bp in length, GC content more than 50%, and the observed/expected ratio of CpG frequency more than 0.6 [23].