The Use of 4-HC in Autologous Purging
Adrian P. Gee in BONE MARROW PROCESSING and PURGING, 2020
This procedure requires a properly prepared graft product. Either buffy coat cells, or light-density cells obtained by density-gradient separation (e.g., Ficoll-Hypaque) may be treated, with adjustment of the 4-HC concentration for the quantity of erythrocytes (and possibly other mature blood cells.30) in the incubation mixture. Two protocols are detailed. The first describes the treatment of buffy coat cells; the second describes treatment of light-density cells obtained by Ficoll-metrizoate or Ficoll-diatrizoate density centrifugation. A single cell suspension, with a concentration at least 2.5 × 107 cells per milliliter (to allow for plasma and drug addition), is necessary to proceed. Autologous plasma should also be collected for the incubation and subsequent cryopreservation; any plasma added to the graft after treatment (i.e., for washing of freezing) must be irradiated (or filtered) to prevent possible reintroduction of tumor cells into the graft.
Bulk Diffusion Methods for Measuring Water Permeability of Biological Membranes
Gheorghe Benga in Water Transport in Biological Membranes, 1989
The theory of Redwood et al.13 requires a system of very closely packed cells with vanishing intercellular space L∘. That is why the method is restricted in application to very high permeability values. Naturally, only populations of cells that fulfill the condition to be packed up to nearly 100%ww can be investigated. In order to satisfy this theoretically founded requirement only cell species can be used for investigation that are very deformable. Erythrocytes, for example, can be closely packed up to ≈98% without substantial cell damage, but other species that are spherically shaped cannot reach values more than 74% at most. Cells with these properties can now be studied on the basis of the more general approach described here. At vanishing extracellular space the solution that has been found coincides with that given by Redwood et al.13 The new approach is not confined to tightly packed cells. It can be used as long as the cell suspension remains homogeneous on a macroscopic scale. The cells need not be deformable, which has been tested using spheric vesicles from heat-fragmented human red blood cells. The variability of the packing density also allows measurements of permeability values in the intermediate range.
Serological Typing of HLA-A, -B, and -C Antigens
M. Kam, Jeffrey L. Bidwell in Handbook of HLA TYPING TECHNIQUES, 2020
The toxic DMSO must now be rapidly removed. The cell suspension should be diluted slowly into 10 times its volume of RPMI (preferably containing FCS or AB serum). Spin at 250 × g for 5 min and wash the cell pellet twice with HBSS.
LINC01128 - miR-16 interaction regulates the migration and invasion of human chorionic trophoblast cells
Published in Hypertension in Pregnancy, 2021
Xinyuan Zhao, Fei Liu, Jin Zhang, Jianhua Zhang, Ludan Zhang, Lin Chen
Matrix gel was diluted by DMEM high-glucose serum-free medium (BD Bioscience, Fran-Klin Lakes, NJ, USA) according to the ratio of 1:8. 100 μL matrix gel was added to a 24-well transwell chamber (Corning Costar, Cambridge, MA) and placed in a 37°C incubator for 24 h to become gel-like. The cells were collected 48 h after transfection. The cell suspension was prepared by using serum-free medium . 100 μL cell suspension at a density of 5 × 104 cells/mL (diluted with serum-free medium) was inoculated into the upper chamber. 600 μL cell suspension containing 10% FBS was added to the lower chamber. After 24 h in a 37°C incubator, the upper noninvasive cells were wiped with a cotton swab. The cells were fixed with 4% paraformaldehyde (YM-MY803J, Yuan mu, Shanghai, China) for 10 min, then stained with 0.1% crystal violet solution (R20756, Yuan ye, Shanghai, China) at room temperature for 15 min. The number of cells was counted under a microscope (Nikon, Tokyo, Japan) at 100× magnification.
Differentiation of spermatogonial stem cells by soft agar three-dimensional culture system
Published in Artificial Cells, Nanomedicine, and Biotechnology, 2019
Elham Mohammadzadeh, Tooba Mirzapour, Mohammad Reza Nowroozi, Hamid Nazarian, Abbas Piryaei, Fatemeh Alipour, Sayed Mostafa Modarres Mousavi, Marefat Ghaffari Novin
Two groups of cells were identified in the cell suspension based on size and morphology. The first group had a diameter of 8–9 micrometers, with irregular edges and round transparent appearance. These cells were proliferated and formed a layer at the bottom of the plate, which was considered as a feeder layer. The second group of the cells was larger than the first one and had a diameter of 15–17 micrometers and their appearance was spherical and had two or three nucleoli outside the center. These cells were proliferated and several colonies with different numbers and diameters appeared in the culture system, so that the average number of colonies was 13.3 ± 0.7 and the average diameter of colonies was 157.8 ± 16.7. In this study, the presence of FSH receptor as a marker on the surface of Sertoli cells was confirmed by immunocytochemistry method. These cells appeared green color (Figure 1(c,d)).
MiR-146b protects against the inflammation injury in pediatric pneumonia through MyD88/NF-κB signaling pathway
Published in Infectious Diseases, 2020
Lei Zhang, Lili Dong, Yu Tang, Min Li, Mingming Zhang
MiR-146b mimic or inhibitor and their negative control (NC) were synthesized by GenePharma Co. (Shanghai, China). MyD88 cDNA was amplified by PCR and cloned into pcDNA3.0 vector (Invitrogen) with a Myc-tag at the C-terminal, designated as MyD88 vector, pcDNA 3.1 vector was used as control vector. MiR-146b mimic or inhibitor was applied for increasing or decreasing miR-146b expression in WI-38 cells. MyD88 vector was used for over-expression of MyD88. 50 nM miR-146b mimic, 100 nM miR-146b inhibitor or MyD88 vector plasmid (2–4 μg) was transfected into WI-38 cells using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, USA) following the manufacturer’s instructions and the transfection was performed for 48 h. The detailed sequences were listed as following: miR-146b mimic (sense UGAGAACUGAAUUCCAUAGGCU and antisense CCUAUGGAAUUCAG UUCUCAUU), miR-146b inhibitor (AGCCUAUGGAAUUCAGUUCUCA), negative control (UGCUUAGUAUAAGAUGCAGGUAG). The WI-38 cells were then treated with or without 5 μg/ml LPS after transfection [7]. The cell suspension was collected for further analysis.
Related Knowledge Centers
- Cell Culture
- Cell Division
- Haematopoiesis
- Hela
- Cell
- Cell Physiology
- Growth Medium
- Suspension
- Homogenization
- Insect Cell Culture