Biocatalysts: The Different Classes and Applications for Synthesis of APIs
Peter Grunwald in Pharmaceutical Biocatalysis, 2019
Penicillium chrysogenum is a β-lactam antibiotics producing industrial microorganism. McLean et al. (2015) metabolically reprogrammed this strain for the synthesis of pravastatin in that they deleted all penicillin biosynthetic genes and introduced the complete compactin gene cluster from Penicillium citrinum. As the modified P. chrysogenum produced higher amounts of compactin lacking the methylbutyrate side chain, the responsible esterase activity was deleted. In addition a new cytochrome P450 (P450 or CYP) from Amycolatopsis orientalis fused to the reductase domain of self-sufficient P450 RhF from Rhodococcus sp. (Nodate et al., 2006) was expressed in the β-lactam–negative P. chrysogenum so that this variant could serve as a platform for pravastatin production through hydroxylating compactin. However, it turned out that the wrong stereoisomer 6-epi-pravastatin was produced almost exclusively. Mutating the CYP105AS1 by error-prone PCR (introduction of active site as well as outer shell mutations) finally resulted in a pravastatin producer yielding more than 6 g/L of this drug. (For recombinant human cytochrome P450 monooxygenases and drug metabolite synthesis, see Schroer et al., 2010).
On Biocatalysis as Resourceful Methodology for Complex Syntheses: Selective Catalysis, Cascades and Biosynthesis
Peter Grunwald in Pharmaceutical Biocatalysis, 2019
Phenoxymethylpenicillin (27a, penicillin V) is produced—like penicillin G (27b)—fermentative in the fungus Penicillium chrysogenum. By the supplementation of phenoxyacetate first the activated CoA-thioester 37 is formed, which competes with the natural precursor benzoyl-CoA (38) (Fig. 21.15). At high substrate concentrations, penicillin V (27a) is predominantly produced. Due to a higher acid stability, penicillin V (27a) can be given orally compared to penicillin G (27b). Penicillin V (27a) is specifically used for the treatment of bacterial infections, like streptococcal pharyngitis (strep throat), caused only by Gram-positive species. It is further less active against Gram-negative bacteria than penicillin G (27b).
Penicillium and Talaromyces
Dongyou Liu in Laboratory Models for Foodborne Infections, 2017
Penicillium species play important roles in the environment, agriculture, and industry. Some species of genus Penicillium are of economic importance to the food industry because they contribute to food ripening, while others are postharvest pathogens or cause spoilage. For example, Penicillium camemberti and Penicillium roqueforti are used for cheese manufacture; Penicillium nalgiovense and Penicillium chrysogenum contribute to ripening of dry-cured meat products. On the other hand, Penicillium expansum is the causal agent of blue mold postharvest rots of apples and is also able to produce patulin and other mycotoxins, as discussed later. Penicillium digitatum and Penicillium italicum are responsible for postharvest citrus decay. Heat-resistant ascospores produced by various Talaromyces spp. cause spoilage of pasteurized juices and other fruit-based products.4
Therapeutic manipulation of gut microbiota by polysaccharides of Wolfiporia cocos reveals the contribution of the gut fungi-induced PGE2 to alcoholic hepatic steatosis
Published in Gut Microbes, 2020
Shanshan Sun, Kai Wang, Li Sun, Baosong Cheng, Shanshan Qiao, Huanqin Dai, Wenyu Shi, Juncai Ma, Hongwei Liu
Direct ITS analysis was performed for fungal species isolates. The ITS1 (TCCGTAGGTGAACCTGCGG) and TIS4 (TCCTCCGCTTATTGATATGC) primers were used for PCR and sequencing. The fungus was identified on the basis of morphology and the DNA sequences of the ITS regions of their ribosomal RNA gene. Analysis of sequences showed homology with that of Meyerozyma guilliermondii (99.64%, accession number: KP675394.1), Penicillium chrysogenum (100%, accession number: MH151126.1), Penicillium citrinum (100%, accession number: KU216720.1), Rhodotorula mucilaginosa (99.65%, accession number: KP960512.1), Cystobasidium slooffiae (99.64%, accession number: MK386939.1), and Fusarium equiseti (99.21%, accession number: KY426410.1) in GenBank.
Advances in green synthesis of nanoparticles
Published in Artificial Cells, Nanomedicine, and Biotechnology, 2019
Aman Gour, Narendra Kumar Jain
Silver and Au NPs have been broadly considered for use in applications in a different scope of fields (e.g. optoelectronics, catalysis, sensing, medicine, etc.). Honey can increase the reduction speed as the concentration is increased in the NPs solution, NPs formed with the mediation of honey are having special characteristics such as bio-sensing, anticorrosive, catalytic and antimicrobial activity [50]. Francis et al. prepared Au and Ag NPs using M. glabrata leaf extract from their respective metal salt precursors by MW assistance. They open a new area for water purification because of their tremendous antimicrobial activity inhibiting pathogenic microorganisms like Bacillus pumilus, Staphylococcus aureus, Pseudomonas aeruginosa, Escherichia coli, Aspergillus niger and Penicillium chrysogenum [51]. An economic method was developed to synthesize Ag NPs of smaller then 140 nm sizes by using two different microorganisms Bacilus subtilus 10833 and Bacilus amylococus 1853, problem with this method was lake of reproducibility, time consuming process (48 h) and impurity issue at some extent [52]. Shen et al. revealed an investigation in which they reported combination of Au NPs from various microorganisms. They compared three different cell free extracts, i.e. bacteria Labrys sp., yeast Trichosporon montevideense, and filamentous fungus Aspergillus sp., selected for AuNPs and at the end of experiment they reported the average sizes of the NPs were 18.8, 22.2 and 9.5 nm, respectively. They found that the fungus showed better results as compared to others [53]. Gonnelli et al. described gold NPs (AuNPs) from concentrates of Cucurbitapepo L. takes off. The examination was completed at various plant ages, from one to four months, and the generation of NPs (in term of size, shape and yield) was dependent on the concentration of chlorophyll and carotenoids in the extracts [46]. A green combination of Ag NPs was created, utilizing a low-toxic system of microemulsion and nanoemulsion with castor oil as the oily phase, Brij 96V and 1,2-hexanediol as the surfactant and co-surfactant individually. Geranium (P. hortorum) leaf aqueous extract was utilized as a reducing specialist [54].
Household dampness and microbial exposure related to allergy and respiratory health in Danish adults
Published in European Clinical Respiratory Journal, 2020
G. Juel Holst, Ad Pørneki, J. Lindgreen, B. Thuesen, J. Bønløkke, A. Hyvärinen, G. Elholm, K. Østergaard, S. Loft, C. Brooks, J. Douwes, A. Linneberg, T. Sigsgaard
The most common microbes found in the dust were: Aspergillus versicolor, Penicillium/Aspergillus/Paecilomyces varioti spp., Cladosporium spp., Streptomyces spp., and Wallemia sebi (Table S1 (supplementary material)). Microbial loads varied greatly between homes, although at least three of the microorganisms were quantifiable in all samples (mean, 7; SD, 2.71). Significant seasonal variation was seen for several microorganisms. Cladosporium spp., Alternaria alternata and the total fungal load were highest during warm months (summer) and lowest during winter months, and Penicillium spp. and Aspergillus spp. was the opposite. Additionally, microbial diversity was lowest during winter (Table S2). On average, dust sampled from homes of atopics contained significantly less Aspergillus fumigatus, Cladosporium sphaerospermum, Penicillium/Aspergillus/Paecilomyces varioti spp., Penicillium chrysogenum, Stachybotrys chartarum/chlorohalonata than dust from homes of non-atopics (Table 3). Significantly less endotoxin and Penicillium/Aspergillus/Paecilomyces varioti spp. were found in dust samples from homes of atopics compared to the random sample. Significantly less Acremonium strictum, Aspergillus fumigatus, Cladosporium herbarum, Cladosporium sphaerospermum, Penicillium chrysogenum, Stachybotrys chartarum/chlorohalonata, but more endotoxin was found in dust from the households in the random sample, and the dust was less diverse in microbial composition than the dust sampled in the homes of non-atopics. Generally, positive but weak correlations were found between groups of microorganisms (r < 0.50), but subgroups of Cladosporium spp. were moderately to highly correlated (r = 0.72 to 0.88), as were Cladosporium spp. and total fungi (r = 0.76 to 0.83) (Table S3). Microbial diversity was significantly but only weakly to moderately correlated with the individual microorganisms (r = 0.18 to 0.73). Few significant differences were found in microbial loads or indicators between homes with and without visible damp stains, mould odor, condensation on windows and moisture damage (Table S4). Among these, a higher load of endotoxin was detected for participant’s reporting having mold odor indoors, whereas the load of endotoxin was lower among participant’s reporting having damp stains in their bedroom.
Related Knowledge Centers
- Metabolite
- Penicillium
- Penicillium Rubens
- Beta-Lactam Antibiotics
- Roquefortine C
- Meleagrin
- 6-Methylsalicylic Acid
- Fungisporin
- Secalonic Acid
- Pr Toxin