Genetics and deoxyribonucleic acid-based technology in clinical biochemistry
Martin Andrew Crook in Clinical Biochemistry & Metabolic Medicine, 2013
DNA can be cut into smaller fragments by restriction endonucleases derived from bacteria. These are named by abbreviating the names of the originating bacteria. These endonucleases often work in a palindromic way, that is, the sequence of bases on one DNA strand is repeated in reverse on the other. A restriction enzyme/restriction endonuclease is an enzyme that recognizes a specific nucleotide sequence (restriction site) and cuts (restricts) the nucleic acid at that particular site. An example of a restriction endonuclease is EcoRI made by Escherichia coli, which is specific for the following sequence: 5′ … GAATTC … 3′3′ … CTTAAG … 5′.
Mitochondrial DNAs and Phylogenetic Relationships
S. K. Dutta in DNA Systematics, 2019
The choice and number of restriction endonucleases in relation to the nucleic acid composition of mtDNA are important in the assessment of mtDNA variation and for the estimation of evolutionary divergence.141 The techniques for the restriction endonuclease mapping of mtDNA are well documented.142 As already indicated an assessment of mtDNA variation by restriction endonuclease mapping can be carried out with differing degrees of resolution, the highest being provided by the methods of Cann and Wilson.143 Estimates of nucleotide sequence diversity can be further supplemented by the alignment and ordering of the fragments relative to a known DNA sequence or with respect to the origin and direction of replication,144,145 so providing information about the distribution of restriction sites within the genome. Where the complete DNA sequence is known for a species, restriction sites may be mapped directly and variation described in relation to functional differentiation of the genome, for example, the rRNA, tRNA, and protein encoding regions. Of course confirmation of the order of restriction fragments can be obtained from double digests with restriction endonucleases as can the presence of insertions and deletions. However, nucleotide substitution at single base pair sites is characteristic of the evolution of mtDNA in higher animals and any length variations are small in size.
Cancer Detection and Prognosis
Attila Lorincz in Nucleic Acid Testing for Human Disease, 2016
The sites recognized by the first enzyme are then detected using autoradiography or phosphor-imaging (Figure 14.1). The sequences corresponding to all restriction sites may be cloned from the second-dimension gel or identified using a NotI/EcoRV boundary library.38,39 Applications of RLGS include high-speed construction of linkage maps, quantitative analysis of copy number at each landmark locus, and detection of mutations involving the restriction sites used to prepare the two-dimensional electrophorograms. The principal limitations are that many of the genetic alterations associated with cancer development are not associated with existing physical maps and that high-resolution analysis of regions of interest is not possible.
Helicobacter pylori PqqE is a new virulence factor that cleaves junctional adhesion molecule A and disrupts gastric epithelial integrity
Published in Gut Microbes, 2021
Miguel S. Marques, Ana C. Costa, Hugo Osório, Marta L. Pinto, Sandra Relvas, Mário Dinis-Ribeiro, Fátima Carneiro, Marina Leite, Ceu Figueiredo
The expression vector pGEX-6P-2 (GE Healthcare) was engineered to co-express HP1012 and HP0657, each with a different tag. To the original vector backbone, a synthetic 109-nucleotide sequence containing a Tac promoter, a ribosome binding site, a sequence of six histidines, and a new SacI restriction site was added (TGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGTATTCATGGGCAGCAGCCATCACCATCATCACCACAGCCA, Sigma), followed by the original EagI restriction sequence. The 109 ssDNA sample was converted to dsDNA by PCR, double-digested with SacI and EagI, and introduced into pGEX-6P-2. (The new vector was named pGEX_His.) All vectors used for protein expression are listed in Supplementary Table S8. For cloning and expression, HP1012 and HP0657 genes were amplified from the genomic DNA of H. pylori 26695, and the PCR products and the plasmid were digested with EcoRI and XhoI or with SacI and EagI (New England Biolabs). All primers used for cloning and sequencing are listed in Supplementary Table S7. Ligation of the PCR products with the pGEX-His plasmid was performed following the instructions for the Quick Ligation™ Kit (New England Biolabs). E. coli strain BL21 (DE3) (NZYtech) was transformed and plated on a Luria Broth Agar medium supplemented with 100 µg/mL of ampicillin (NZYtech). Transformants were selected upon overnight incubation at 37°C. Plasmid extraction was performed using the NZYMiniprep kit (NZYtech) following the manufacturer’s instructions.
Development of potent and effective synthetic SARS-CoV-2 neutralizing nanobodies
Published in mAbs, 2021
Maxwell A. Stefan, Yooli K. Light, Jennifer L. Schwedler, Peter R. McIlroy, Colleen M. Courtney, Edwin A. Saada, Christine E. Thatcher, Ashlee M. Phillips, Feliza A. Bourguet, Catherine M. Mageeney, Summer A. McCloy, Nicole M. Collette, Oscar A. Negrete, Joseph S. Schoeniger, Dina R. Weilhammer, Brooke Harmon
Synthetic VHH library was designed as follows. A high diversity library was designed by incorporating the natural prevalence of amino acids at positions in CDR1 and CDR2 based off 670 functional VHH antibodies deposited on sdAb-DB (www.sdab-db.ca).14 Amino acids cysteine and methionine were omitted from all CDR loops and full diversity was used for CDR3. Asparagine was also omitted from CDR1 and CDR2. The library was also designed such that there would be 3 different lengths of CDR3 (9-, 12-, and 15-amino acids). Linear double-stranded DNA fragments incorporating the specifications mentioned above, as well as terminal flanking BglI restriction sites, were synthetically produced commercially by Twist Bioscience. A humanized VHH framework characterized in Moutel et al.15 was used to house the designer CDRs.
Recent advances in screening and diagnosis of hemoglobinopathy
Published in Expert Review of Hematology, 2020
Kanjaksha Ghosh, Kinjalka Ghosh, Reepa Agrawal, Anita H. Nadkarni
RFLP-based diagnosis using proper restriction endonucleases for an amplified product can easily detect some of the common hemoglobinopathies like Hb S (Abolition of restriction site for Dde1) or Hb D Punjab (creation of new restriction site for Eco R1) BseR1 for Hb O-Arab or Eae1 for Hb Q India. Many new restriction sites can be designed for different mutations in reference laboratories and after testing their validity they can be used in downstream laboratories using this simple technique. The Technique requires a PCR machine, electrophoresis, and a gel documentation system. Simple camera can also replace the costlier Gel documentation system for the purpose.
Related Knowledge Centers
- DNA
- DNA Ligase
- Ecori
- Nucleotide
- Protein Dimer
- Restriction Enzyme
- Restriction Fragment Length Polymorphism
- Palindromic Sequence
- Nullomers